Text Size:AAA

Human VEGFA transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
VEGF-AcDNA Clone Product Information
Gene Bank Ref.ID:NM_001171626.1
cDNA Size:576
cDNA Description:ORF Clone of Homo sapiens vascular endothelial growth factor A transcript variant 4 DNA.
Gene Synonym:VEGF165, VPF, VEGF, MVCD1
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Vascular Endothelial Growth Factor (VEGF) & Receptor Related Products
Product nameProduct name
Human VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGF 183 / VEGF-A ProteinMouse VEGFA / VEGF164 ProteinHuman VEGF121 / VEGF-A ProteinMouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Mouse PIGF / PLGF Protein (Fc Tag)Rat VEGF164 / VEGFA ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGF121 / VEGF-A ProteinMouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinDanio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinMouse VEGF-D / VEGFD / FIGF Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Mouse PIGF / PLGF ProteinHuman VEGF121b / VEGF-A ProteinCanine VEGF / VEGFA ProteinHuman Neuropilin 2 / NRP2 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 Protein

Vascular endothelial growth factor (VEGF), also known as vascular permeability factor (VPF) and VEGF-A, is a potent mediator of both angiogenesis and vasculogenesis in the fetus and adult. It is a member of the platelet-derived growth factor (PDGF)/vascular endothelial growth factor (VEGF) family and often exists as a disulfide-linked homodimer. VEGF-A protein is a glycosylated mitogen that specifically acts on endothelial cells and has various effects, including mediating increased vascular permeability, inducing angiogenesis, vasculogenesis and endothelial cell growth, promoting cell migration, inhibiting apoptosis and tumor growth. VEGF-A protein is also a vasodilator that increases microvascular permeability, thus it was originally referred to as vascular permeability factor.

  • Woolard J. et al. (2004) VEGF165b, an inhibitory vascular endothelial growth factor splice variant: mechanism of action, in vivo effect on angiogenesis and endogenous protein expression. Cancer Res. 64(21): 7822-7835.
  • Jia SF, et al. (2008) VEGF165 is necessary to the metastatic potential of Fas(-) osteosarcoma cells but will not rescue the Fas(+) cells. J Exp Ther Oncol. 7(2): 89-97.
  • Cimpean AM, et al. (2008) Vascular endothelial growth factor A (VEGF A) as individual prognostic factor in invasive breast carcinoma. Rom J Morphol Embryol. 49(3): 303-8.
  • Hamdollah Zadeh MA, et al. (2008) VEGF-mediated elevated intracellular calcium and angiogenesis in human microvascular endothelial cells in vitro are inhibited by dominant negative TRPC6. Microcirculation. 15(7): 605-14.
  • Eisenach PA, et al. (2010) MT1-MMP regulates VEGF-A expression through a complex with VEGFR-2 and Src. J Cell Sci. 123(Pt 23):4182-4193.
  • Claesson-Welsh L (2010) Gremlin: vexing VEGF receptor agonist. Blood. 116(18):3386-7.
  • Catalog:HG11066-G-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human VEGFA transcript variant 4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged