Quick Order

Text Size:AAA

Human TrkC/NTRK3 transcript variant 3 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TrkC/NTRK3 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:
Storage:
Human TrkC/NTRK3 Gene Plasmid Map
Human TrkC transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

NT-3 growth factor receptor also known as neurotrophic tyrosine kinase receptor type 3 or TrkC tyrosine kinase or Trk-C receptor, is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. TrkC/NTRK3 is widely expressed in the developing and adult nervous system. In later embryonic development, TrkC/NTRK3 is expressed in various structures of the CNS including the caudatoputamen, septal nuclei, cerebellum, and brainstem. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. In the PNS, trkC hybridization appears to correlate, both temporally and spatially, with the outgrowth of axons toward their peripheral targets. TrkC/NTRK3 is widely expressed in the three identified branches of the mammalian nervous system and appears to correlate with the expression of NT-3, its cognate ligand. The apparent colocalization of trkC transcripts with NT-3 raises the possibility this neurotrophin exerts its trophic effects by a paracrine and/or autocrine mechanism. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in TrkC encoding gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers.

References
  • Tessarollo L, et al. (1993) trkC, a receptor for neurotrophin-3, is widely expressed in the developing nervous system and in non-neuronal tissues. Development. 118(2): 463-75.
  • Lamballe F, et al. (1994) Developmental expression of trkC, the neurotrophin-3 receptor, in the mammalian nervous system. J Neurosci. 14(1): 14-28.
  • Klein R, et al. (1994) Disruption of the neurotrophin-3 receptor gene trkC eliminates la muscle afferents and results in abnormal movements. Nature. 368(6468): 249-51.
  • Contact Us
    Images
    • Human TrkC transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"