Quick Order

Human TrkB/NTRK2 transcript variant b Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TrkB/NTRK2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human TrkB/NTRK2 Gene Plasmid Map
Human TrkB transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

TrkB receptor also known as TrkB tyrosine kinase or BDNF/NT-3 growth factors receptor or neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) is a single transmembrane catalytic receptors with intracellular tyrosine kinase activity. TrkB/NTRK2 is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. TrkB tyrosine kinase (TrkB) or NTRK2 is coupled to the Ras, Cdc42/Rac/RhoG, MAPK, PI3-K and PLCgamma signaling pathways. There are four members of the Trk family; TrkA, TrkB and TrkC and a related p75NTR receptor. Each family member binds different neurotrophins with varying affinities. TrkB/NTRK has highest affinity for brain-derived neurotrophic factor (BDNF) and is involved in neuronal plasticity, longterm potentiation and apoptosis of CNS neurons. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. TrkB/NTRK is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in TrkB/NTRK have been associated with obesity and mood disorders.

References
  • Klein R, et al. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell. 61 (4): 647-56.
  • Rose CR, et al. (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature. 426 (6962): 74-8.
  • Yamada K, et al. (2004) Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci. 91 (4): 267-70.
  • Contact Us
    Images
    • Human TrkB transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"