After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human TrkB/NTRK2 transcript variant b Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TrkB/NTRK2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human TrkB/NTRK2 Gene Plasmid Map
Human TrkB transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

TrkB receptor also known as TrkB tyrosine kinase or BDNF/NT-3 growth factors receptor or neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) is a single transmembrane catalytic receptors with intracellular tyrosine kinase activity. TrkB/NTRK2 is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. TrkB tyrosine kinase (TrkB) or NTRK2 is coupled to the Ras, Cdc42/Rac/RhoG, MAPK, PI3-K and PLCgamma signaling pathways. There are four members of the Trk family; TrkA, TrkB and TrkC and a related p75NTR receptor. Each family member binds different neurotrophins with varying affinities. TrkB/NTRK has highest affinity for brain-derived neurotrophic factor (BDNF) and is involved in neuronal plasticity, longterm potentiation and apoptosis of CNS neurons. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. TrkB/NTRK is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in TrkB/NTRK have been associated with obesity and mood disorders.

  • Klein R, et al. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell. 61 (4): 647-56.
  • Rose CR, et al. (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature. 426 (6962): 74-8.
  • Yamada K, et al. (2004) Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci. 91 (4): 267-70.
  • Contact Us
    • Human TrkB transcript variant b Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.