Text Size:AAA
DatasheetReviewsRelated ProductsProtocols
Human TWF1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human TWF1 Gene Plasmid Map
Human TWF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Twinfilin-1, also known as Protein A6, Protein tyrosine kinase 9, TWF1 and PTK9, is a cytoplasm protein which belongs to the actin-binding proteins ADF family and Twinfilin subfamily. Twinfilin-1 (TWF1 / PTK9 ) is a highly conserved actin monomer-binding protein that regulates cytoskeletal dynamics in organisms from yeast to mammals. In addition to the mammalian twinfilin-1, a second protein with approximately 65% sequence identity to twinfilin-1 exists in mouse and humans. TWF1 / PTK9 is expressed at high levels in the colon, testis, ovary, prostate and lung. It is expressed at lower levels in the brain, bladder and heart. It is not detected in liver. TWF1 / PTK9 is an actin-binding protein involved in motile and morphological processes. It inhibits actin polymerization, likely by sequestering G-actin. By capping the barbed ends of filaments, it also regulates motility. TWF1 / PTK9 seems to play an important role in clathrin-mediated endocytosis and distribution of endocytic organelles.

References
  • Beeler JF, et al.,1994, Mol Cell Biol 14 (2): 982-8.
  • Palmgren S, et al., 2002, J. Cell. Sci. 115 (Pt 5): 881-6.
  • Vartiainen MK, et al.,2003, J. Biol. Chem. 278 (36): 34347-55.
  • Hassel S, et al.,2004, Proteomics 4 (5): 1346-58.
  • Moseley,J.B. et al., 2006, J Cell Sci. 119 (Pt 8):1547-57.
  • Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"