After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Mouse TNFSF10 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Mouse TNFSF10 Gene Plasmid Map
Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Tumor necrosis factor ligand superfamily member 10 (TNFSF10), also known as TNF-related apoptosis-inducing ligand (TRAIL), Apo-2 ligand, and CD253, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. TNFSF10 / Apo-2L / CD253 functions as a ligand that induces the process of cell death called apoptosis. TNFSF10 / TRAIL shows homology to other members of the tumor necrosis factor superfamily. As one member of the cluster of differentiation system, TNFSF10 / CD253 is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion TNFSF10 / Apo-2L / CD253 / TRAIL binds to several members of TNF receptor superfamily including TNFRSF10A / TRAILR1, TNFRSF10B / TRAILR2, TNFRSF10C / TRAILR3, TNFRSF10D / TRAILR4, and possibly also to TNFRSF11B/OPG. The activity of TNFSF10 / TRAIL may be modulated by binding to the decoy receptors TNFRSF10C / TRAILR3, TNFRSF10D/TRAILR4, and TNFRSF11B/OPG that cannot induce apoptosis. The binding of this protein to its receptors has been shown to trigger the activation of MAPK8 / JNK, caspase 8, and caspase 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

References
  • Song C, et al. (2005) TRAIL (CD253), a new member of the TNF superfamily. J Biol Regul Homeost Agents. 19(1-2): 73-7.
  • Kuribayashi K, et al. (2008) TNFSF10 (TRAIL), a p53 target gene that mediates p53-dependent cell death. Cancer Biol Ther. 7(12): 2034-8.
  • Wiley SR, et al. (1995) Identification and characterization of a new member of the TNF family that induces apoptosis. Immunity. 3(6): 673-82.
  • Contact Us
    Images
    • Mouse TNFSF10 / TRAIL Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"