Quick Order

DatasheetReviewsRelated ProductsProtocols
Human TNFRSF18 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human TNFRSF18 Gene Plasmid Map
Human TNFRSF18 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

GITR, also known as TNFRSF18(CD357), belongs to the tumor necrosis factor receptor (TNF-R) superfamily. It is the receptor for TNFSF18. GITR plays a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. GITR may be involved in interactions between activated T-lymphocytes and endothelial cells and in the regulation of T-cell receptor-mediated cell death. GITR and its ligand are important costimulatory molecules in the pathogenesis of autoimmune diseases. It also mediates NF-kappa-B activation via the TRAF2/NIK pathway.

References
  • Kwon B, et al. (1999) Identification of a novel activation-inducible protein of the tumor necrosis factor receptor superfamily and its ligand. J Biol Chem. 274(10):6056-61.
  • Nocentini G, et al. (1997) A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci. 94(12): 6216-21.
  • Baltz KM, et al. (2007) Cancer immunoediting by GITR (glucocorticoid-induced TNF-related protein) ligand in humans: NK cell/tumor cell interactions. FASEB J. 21(10):2442-54.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"