TWEAKR cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

TWEAKR cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
390 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tumor necrosis factor receptor superfamily, member 12A with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 0.44kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

TWEAKR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TWEAKR cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag tag: Alternative Names

CD266 cDNA ORF Clone, Human; FN14 cDNA ORF Clone, Human; TWEAKR cDNA ORF Clone, Human

TWEAKR Background Information

Fn14 (tumor necrosis factor receptor superfamily, member 12A), also known as TNFRSF12A, is the receptor for TNFSF12/TWEAK. Fn14 shares 82% amino acid identity with the mouse sequence. It contains a signal peptide, an extracellular domain, a membrane-anchoring domain, and a cytoplasmic domain. In response to FGF1, calf serum, or phorbol ester stimulation of human quiescent fibroblasts in vitro, the level of Fn14 is increased. A 1.2-kb FN14 transcript was expressed at high levels in heart, placenta, and kidney, at intermediate levels in lung, skeletal muscle, and pancreas, and at low levels in brain and liver. In addition, elevated FN14 expression was found in human liver cancer cell lines and hepatocellular carcinoma specimens. Expression of mouse Fn14 was upregulated in hepatocellular carcinoma nodules that develop in 2 different transgenic mouse models of hepatocarcinogenesis. TNFRSF12A is the weak inducer of apoptosis in some cell types. It promotes angiogenesis and the proliferation of endothelial cells. TNFRSF12A may modulate cellular adhesion to matrix proteins.
Full Name
tumor necrosis factor receptor superfamily member 12A
References
  • Burkly LC, et al. (2011) The TWEAK/Fn14 pathway in tissue remodeling: for better or for worse. Adv Exp Med Biol. 691:305-22.
  • Huang M, et al. (2011) Overexpression of Fn14 promotes androgen-independent prostate cancer progression through MMP-9 and correlates with poor treatment outcome. Carcinogenesis. 32(11):1589-96.
  • Dharmapatni AA, et al. (2011) TWEAK and Fn14 expression in the pathogenesis of joint inflammation and bone erosion in rheumatoid arthritis. Arthritis Res Ther. 13(2):R51.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait