After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human TNFRSF11B cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human TNFRSF11B Gene Plasmid Map
Human TNFRSF11B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Osteoprotegerin or TNFRSF11B is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. Osteoprotegerin/TNFRSF11B acts as decoy receptor for RANKL and thereby neutralizes its function in osteoclastogenesis. This protein may inhibit the activation of osteoclasts and promotes osteoclast apoptosis in vitro. Bone homeostasis seems to depend on the local RANKL/OPG ratio. Osteoprotegerin/TNFRSF11B also play a role in preventing arterial calcification, act as decoy receptor for TRAIL and protect against apoptosis. TRAIL binding blocks the inhibition of osteoclastogenesis.

  • Collin-Osdoby P. (2005) Regulation of vascular calcification by osteoclast regulatory factors RANKL and osteoprotegerin. Circ Res. 95 (11): 1046-57.
  • Boyce BF, et al. (2007) Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res. Ther. 9 Suppl 1: S1.
  • Blázquez-Medela AM, et al. ( 2011) Osteoprotegerin and diabetes-associated pathologies. Curr Mol Med. 11 (5): 401-16.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.