Quick Order

Human TRAIL R2/CD262/TNFRSF10B Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human TNFRSF10B cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor 5, CD262, TNF-related apoptosis-inducing ligand receptor 2 (TRAIL R2), is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R2/CD262/TNFRSF10B was purified independently as the only receptor for TRAIL detectable on the surface of two different human cell lines that undergo apoptosis upon stimulation with TRAIL. TRAIL R2/CD262/TNFRSF10B contains two extracellular cysteine-rich repeats, typical for TNF receptor (TNFR) family members, and a cytoplasmic death domain. TRAIL R2/CD262/TNFRSF10B mediates apoptosis via the intracellular adaptor molecule FADD/MORT1. TRAIL receptors can signal both death and gene transcription, functions reminiscent of those of TNFR1 and TRAMP, two other members of the death receptor family. Defects in TRAIL R2/CD262/TNFRSF10B may be a cause of head and neck squamous cell carcinomas (HNSCC) also known as squamous cell carcinoma of the head and neck.

  • Schneider P, et al. (1997) TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-kappaB. Immunity. 7(6): 831-6.
  • Ichikawa K, et al. (2003) TRAIL-R2 (DR5) mediates apoptosis of synovial fibroblasts in rheumatoid arthritis. J Immunol. 171(2): 1061-9.
  • Walczak H, et al. (1997) TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J. 16(17): 5386-97.
  • Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.