Quick Order

Human TRAIL R2/CD262/TNFRSF10B Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human TNFRSF10B cDNA Clone Product Information
    NCBI RefSeq:
    RefSeq ORF Size:
    cDNA Description:
    Gene Synonym:
    Species:Human
    Vector:
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with TNFRSF10B qPCR primers for gene expression analysis, HP100049 )
    Promoter:
    Application:
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:
    Shipping_carrier:
    Storage:
    pCMV/hygro Vector Information
     
    Vector Name pCMV/hygro
    Vector Size 5657bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive ,Stable / Transient
    Promoter CMV
    Antibiotic Resistance Ampicillin
    Selection In Mammalian Cells Hygromycin
    Protein Tag None
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)


    Schematic of pCMV/hygro Multiple Cloning Sites
    Product nameProduct name
    Background

    Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor 5, CD262, TNF-related apoptosis-inducing ligand receptor 2 (TRAIL R2), is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R2/CD262/TNFRSF10B was purified independently as the only receptor for TRAIL detectable on the surface of two different human cell lines that undergo apoptosis upon stimulation with TRAIL. TRAIL R2/CD262/TNFRSF10B contains two extracellular cysteine-rich repeats, typical for TNF receptor (TNFR) family members, and a cytoplasmic death domain. TRAIL R2/CD262/TNFRSF10B mediates apoptosis via the intracellular adaptor molecule FADD/MORT1. TRAIL receptors can signal both death and gene transcription, functions reminiscent of those of TNFR1 and TRAMP, two other members of the death receptor family. Defects in TRAIL R2/CD262/TNFRSF10B may be a cause of head and neck squamous cell carcinomas (HNSCC) also known as squamous cell carcinoma of the head and neck.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Schneider P, et al. (1997) TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-kappaB. Immunity. 7(6): 831-6.
  • Ichikawa K, et al. (2003) TRAIL-R2 (DR5) mediates apoptosis of synovial fibroblasts in rheumatoid arthritis. J Immunol. 171(2): 1061-9.
  • Walczak H, et al. (1997) TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J. 16(17): 5386-97.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"