Text Size:AAA

Human TRAILR1 / TNFRSF10A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TRAILR1/TNFRSF10AcDNA Clone Product Information
Gene Bank Ref.ID:NM_003844.2
cDNA Size:1407
cDNA Description:ORF Clone of Homo sapiens tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A) DNA.
Gene Synonym:DR4, APO2, CD261, MGC9365, TRAILR1, TRAILR-1, TNFRSF10A
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Tumor Necrosis Factor (TNF) & Receptor Related Products
Product nameProduct name
Human 4-1BBL / CD137L Protein (Fc Tag, ECD)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (ECD, Fc Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinHuman CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 ProteinHuman FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNF-alpha / TNFA ProteinHuman TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Mouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His & Fc Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinHuman DR6 / TNFRSF21 Protein (His Tag)Human TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human RELT / TNFRSF19L Protein (His Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Canine TNF-alpha / TNFA / TNFSF1A ProteinHuman EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human Osteoprotegerin / TNFRSF11B Protein (His Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human HVEM / TNFRSF14 Protein (His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman XEDAR / EDA2R Protein (His Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Cynomolgus / Rhesus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinHuman TNFRSF13B / TACI / CD267 Protein (His Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinMouse PGLYRP1 / PGRP-S Protein (His Tag)Mouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Rat TNF-alpha / TNFA ProteinFerret TNF-alpha / TNFA ProteinHuman TNFSF10 / TRAIL / APO-2L / CD253 ProteinMouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Mouse NGFR / P75 Protein (Fc Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinMouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat EDAR Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Cynomolgus TNFSF10 / TRAIL / APO-2L ProteinRat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag) Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat TNFSF15 / TL1A Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (His Tag)Cynomolgus / Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Cynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Cynomolgus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 ProteinCynomolgus CD27 / TNFRSF7 Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Cynomolgus CD40L / CD154 / TNFSF5 Protein (Fc Tag) Human TNFRSF19 / TROY Protein (His Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Canine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)Canine CD40 / TNFRSF5 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Canine CD40 / TNFRSF5 ProteinHuman Fas Ligand / FASLG / CD95L Protein (His Tag)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD40 / TNFRSF5 Protein (His Tag)Human TNFRSF11A Protein (Fc Tag)Human TNF-alpha / TNFA Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)
Background

Tumor necrosis factor receptor superfamily, member 10a (TRAIL R1), also known as TRAIL receptor 1 (TRAIL R1) or CD261 antigen, is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R1/CD261/TNFRSF10A serves as a receptor for the cytotoxic ligand TNFSF10/TRAIL. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. TRAIL R1 can promote the activation of NF-kappa-B. TRAIL R1/CD261/TNFRSF10A induces apoptosis of many transformed cell lines but not of normal tissues, even though its death domain-containing receptor, DR4, is expressed on both cell types.

References
  • Kimberley FC, et al. (2005) Following a TRAIL: update on a ligand and its five receptors.". Cell Res. 14 (5): 359–72.
  • Schneider P, et al. (1997) Characterization of two receptors for TRAIL.". FEBS Lett. 416 (3): 329–34.
  • Catalog:HG10408-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human TRAILR1 / TNFRSF10A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"