Customer experience is always our first concern. Purchase can be made in your local currency now. Explore our website for more!
Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human TRAILR1/TNFRSF10A cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human TRAILR1/TNFRSF10A Gene Plasmid Map
Human TRAILR1 / TNFRSF10A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Tumor necrosis factor receptor superfamily, member 10a (TRAIL R1), also known as TRAIL receptor 1 (TRAIL R1) or CD261 antigen, is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R1/CD261/TNFRSF10A serves as a receptor for the cytotoxic ligand TNFSF10/TRAIL. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. TRAIL R1 can promote the activation of NF-kappa-B. TRAIL R1/CD261/TNFRSF10A induces apoptosis of many transformed cell lines but not of normal tissues, even though its death domain-containing receptor, DR4, is expressed on both cell types.

References
  • Kimberley FC, et al. (2005) Following a TRAIL: update on a ligand and its five receptors.". Cell Res. 14 (5): 359–72.
  • Schneider P, et al. (1997) Characterization of two receptors for TRAIL.". FEBS Lett. 416 (3): 329–34.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"