Our new search engine has been launched. Welcome to use it and experience it. If you have any suggestions, welcome to contact us!
Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human TRAILR1/TNFRSF10A cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human TRAILR1/TNFRSF10A Gene Plasmid Map
Human TRAILR1 / TNFRSF10A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Tumor necrosis factor receptor superfamily, member 10a (TRAIL R1), also known as TRAIL receptor 1 (TRAIL R1) or CD261 antigen, is a member of the TNF-receptor superfamily. This receptor is activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL), and thus transduces cell death signal and induces cell apoptosis. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R1/CD261/TNFRSF10A serves as a receptor for the cytotoxic ligand TNFSF10/TRAIL. The adapter molecule FADD recruits caspase-8 to the activated receptor. The resulting death-inducing signaling complex (DISC) performs caspase-8 proteolytic activation which initiates the subsequent cascade of caspases (aspartate-specific cysteine proteases) mediating apoptosis. TRAIL R1 can promote the activation of NF-kappa-B. TRAIL R1/CD261/TNFRSF10A induces apoptosis of many transformed cell lines but not of normal tissues, even though its death domain-containing receptor, DR4, is expressed on both cell types.

  • Kimberley FC, et al. (2005) Following a TRAIL: update on a ligand and its five receptors.". Cell Res. 14 (5): 359–72.
  • Schneider P, et al. (1997) Characterization of two receptors for TRAIL.". FEBS Lett. 416 (3): 329–34.
  • Contact Us
    • Human TRAILR1 / TNFRSF10A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.