_×
Human TNFA Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human TNFA Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

Human TNFA Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG10602-M-M
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

TNFα cDNA Clone Datasheet

 

TNFα cDNA Clone Product Information

Gene Bank Ref.ID:

NM_000594.2

cDNA Size:

702

Gene Synonym:

DIF; TNFA; TNFSF2; TNF-alpha; TNF

Source: Human

TNFα cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens tumor necrosis factor (TNF superfamily, member 2) DNA.

Vector:

pCMV/hygro-Myc

Myc Tag Sequence: CAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description: Identical with the Gene Bank Ref. ID sequence.

TNFα cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

TNFα cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

TNFα cDNA Clone Sequence and Quality Control

Sequence:

1        ATGAGCACTG AAAGCATGAT CCGGGACGTG GAGCTGGCCG AGGAGGCGCT CCCCAAGAAG
61       ACAGGGGGGC CCCAGGGCTC CAGGCGGTGC TTGTTCCTCA GCCTCTTCTC CTTCCTGATC
121      GTGGCAGGCG CCACCACGCT CTTCTGCCTG CTGCACTTTG GAGTGATCGG CCCCCAGAGG
181      GAAGAGTTCC CCAGGGACCT CTCTCTAATC AGCCCTCTGG CCCAGGCAGT CAGATCATCT
241      TCTCGAACCC CGAGTGACAA GCCTGTAGCC CATGTTGTAG CAAACCCTCA AGCTGAGGGG
301      CAGCTCCAGT GGCTGAACCG CCGGGCCAAT GCCCTCCTGG CCAATGGCGT GGAGCTGAGA
361      GATAACCAGC TGGTGGTGCC ATCAGAGGGC CTGTACCTCA TCTACTCCCA GGTCCTCTTC
421      AAGGGCCAAG GCTGCCCCTC CACCCATGTG CTCCTCACCC ACACCATCAG CCGCATCGCC
481      GTCTCCTACC AGACCAAGGT CAACCTCCTC TCTGCCATCA AGAGCCCCTG CCAGAGGGAG
541      ACCCCAGAGG GGGCTGAGGC CAAGCCCTGG TATGAGCCCA TCTATCTGGG AGGGGTCTTC
601      CAGCTGGAGA AGGGTGACCG ACTCAGCGCT GAGATCAATC GGCCCGACTA TCTCGACTTT
661      GCCGAGTCTG GGCAGGTCTA CTTTGGGATC ATTGCCCTGG CT1GAGCAGAA ACTCATCTCA
721      GAAGAGGATC TG2TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. Myc Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 

All TNF Proteins

Product nameProduct name
4-1BB / CD137 / TNFRSF9 ProteinNGFR/ P75 Protein (His Tag)
4-1BB / CD137 / TNFRSF9 Protein (His Tag)Mouse PGLYRP / TNFSF3L Protein (His Tag)
Mouse 4-1BB / TNFRSF9 / CD137 ProteinRELT / TNFRSF19L Protein
Canine 4-1BB / TNFRSF9 Protein (His Tag)RELT / TNFRSF19L Protein (His Tag)
Mouse 4-1BBL / TNFSF9 ProteinTNFa Protein (Native)
Rat TNFSF9 Protein Mouse TNFa Protein (Native)
Rat TNFSF9 Protein (His Tag)Canine TNFa / TNFSF1A Protein (Native)
BAFF / TNFSF13B ProteinCynomolgus TNFa / TNFSF1A Protein (Native)
BAFF / TNFSF13B ProteinRat TNFa / TNF-alpha Protein (Native)
BAFF / TNFSF13B Protein (Native)Ferret TNFa / TNF-alpha Protein (Native)
Cynomolgus BAFF / TNFSF13B ProteinTNFRSF1A / TNFRI / CD120a Protein
Mouse BAFFR / TNFRSF13C / CD268 ProteinTNFRSF1A / TNFRI / CD120a Protein (His Tag)
Rat BAFFR / TNFRSF13C Protein (His Tag)Mouse TNFRSF1A / TNFRI / CD120a Protein (His Tag)
Rat BAFFR / TNFRSF13C ProteinMouse TNFRI / TNFRSF1A / CD120a Protein
CD27 / TNFRSF7 ProteinRat TNFRSF1A / TNFR1 Protein
Mouse CD27 / TNFRSF7 ProteinRat TNFRSF1A / TNFR1 Protein (His Tag)
Mouse CD27 / TNFRSF7 Protein (His Tag)TNFRSF1B / TNFR2 / CD120b Protein
CD27 / TNFRSF7 ProteinTNFRSF1B / TNFR2 / CD120b Protein (His Tag)
Cynomolgus CD27 / TNFRSF7 ProteinMouse TNFRSF1B / TNFR2 / CD120b Protein
CD27 / TNFRSF7 Protein (His Tag)Mouse TNFRSF1B / TNFR2 / CD120b Protein (His Tag)
CD30 Ligand / TNFSF8 ProteinCynomolgus TNFRSF1B Protein (His Tag)
Rat CD30 Ligand / TNFSF8 ProteinCynomolgus TNFRSF1B Protein
Cynomolgus CD30 Ligand / TNFSF8 ProteinTNFRSF1B (aa 1-268, 196 Met / Arg) Protein (His Tag)
Cynomolgus CD30 Ligand / TNFSF8 Protein (His Tag)Rat TNFRSF11A Protein (His Tag)
Rat CD30 Ligand / TNFSF8 ProteinRat TNFRSF11A Protein
CD40 / TNFRSF5 ProteinTNFRSF11B / OCIF Protein (His Tag)
CD40 / TNFRSF5 Protein (His Tag)Cynomolgus TNFRSF11B Protein
Mouse CD40 / TNFRSF5 ProteinFn14 / TNFRSF12A Protein
Rat TNFRSF5 / CD40 ProteinTNFRSF13B / TACI / CD267 Protein (His Tag)
Rat TNFRSF5 / CD40 Protein (His Tag)TNFRSF14 / HVEA / HVEM Protein
Cynomolgus TNFRSF5 / CD40 ProteinMouse HVEM / TNFRSF14 Protein
Cynomolgus TNFRSF5 / CD40 Protein (His Tag)TNFRSF14 / HVEA / HVEM Protein (His Tag)
Canine TNFRSF5 / CD40 ProteinCynomolgus TNFRSF14 / HVEA / HVEM Protein
Canine TNFRSF5 / CD40 ProteinMouse TNFRSF14 / HVEA / HVEM Protein
Canine TNFRSF5 / CD40 Protein (His Tag)Mouse TNFRSF17 Protein
CD40L / CD154 / TNFSF5 Protein (His Tag)Mouse BCMA / TNFRSF17 Protein
CD40L / CD154 / TNFSF5 ProteinTNFRSF17 / BCMA / CD269 Protein
Mouse CD40L / CD154 / TNFSF5 ProteinRat TNFRSF17 Protein
Rat CD40LG / CD40L / TNFSF5 ProteinCynomolgus TNFRSF17 Protein
Cynomolgus CD40LG / CD40L / TNFSF5 Protein Rat GITR / TNFRSF18 Protein
Canine CD40LG / CD40L / TNFSF5 ProteinGITR / TNFRSF18 Protein
Canine CD40LG / CD40L / TNFSF5 ProteinMouse TNFRSF19 / TROY Protein
CD70 / CD27L / TNFSF7 ProteinMouse TNFRSF19 / TROY Protein (His Tag)
Rat CD70 ProteinTNFRSF19 / TROY Protein
Rat CD70 Protein (His Tag)TNFRSF19 / TROY Protein (His Tag)
FAS / TNFRSF6 / CD95 ProteinTNFRSF25 / DDR3 / APO3 Protein (Fc Tag)
Mouse FAS / TNFRSF6 / CD95 Protein (His Tag)TNFRSF4 / CD134 Protein
CD95 / Fas / TNFRSF6 Protein (His Tag)TNFRSF4 / CD134 Protein (His Tag)
Rat FAS / TNFRSF6 / CD95 Protein (His Tag)Mouse OX40 / CD134 / TNFRSF4 Protein
Rat FAS / TNFRSF6 / CD95 ProteinCD30 / TNFRSF8 Protein
Cynomolgus FAS / TNFRSF6 / CD95 ProteinTNFRSF8 / CD30 Protein (His Tag)
Cynomolgus FAS / TNFRSF6 / CD95 ProteinTNFSF10 / APO2L / TRAIL / CD253 Protein (His Tag)
Fas Ligand / FASLG / CD95L Protein (His Tag)TNFSF10 / APO2L / TRAIL / CD253 Protein (Native)
DcR3 / TNFRSF6B Protein (His Tag)Mouse TNFSF10 (aa 118-291) Protein (His Tag)
DCR3 / TNFRSF6B ProteinCynomolgus TNFSF10 Protein (Native)
DR6 / TNFRSF21 ProteinTNFSF11 / RANKL / CD254 Protein
DR6 / TNFRSF21 ProteinMouse TNFSF11 / OPGL / CD254 Protein
DR6 / TNFRSF21 Protein (His Tag)TNFSF11 / OPGL / CD254 Protein
Mouse DR6 / TNFRSF21 Protein (His Tag)TNFSF11 / OPGL / CD254 Protein
EDA2R / XEDAR / TNFRSF27 Protein (His Tag)RANKL / OPGL / TNFSF11 / CD254 Protein
Rat EDA2R / TNFRSF27 ProteinCynomolgus RANKL / OPGL / TNFSF11 Protein
Rat EDA2R / TNFRSF27 Protein (His Tag)Rat TNFSF12 Protein
Mouse EDA2R / TNFRSF27 ProteinCynomolgus / Human TNFSF12 Protein
Cynomolgus XEDAR / EDA2R / TNFRSF27 ProteinMouse TNFSF13 Protein
EDAR / DL ProteinRat TNFSF15 / TL1A Protein
EDAR / DL Protein (His Tag)Cynomolgus OX-40L / TNFSF4 Protein
Rat EDAR ProteinTNFRSF10A / CD261 / APO2 Protein
Cynomolgus EDAR ProteinTNFRSF10A / CD261 / APO2 Protein
Cynomolgus EDAR Protein (His Tag)TNFRSF10A / CD261 / APO2 Protein (His Tag)
TNFSF14 ProteinTNFRSF10B / TRAILR2 / CD262 Protein
LTA / TNFB / TNF-beta Protein (Native)TNFRSF10B / TRAILR2 / CD262 Protein (His Tag)
Rat LTBR Protein (His Tag)Mouse TRAILR2 / TNFRSF10B Protein (His Tag)
Cynomolgus LTBR ProteinMouse TRAILR2 / TNFRSF10B Protein
Rat LTBR ProteinTRAILR4 / TNFRSF10D / DCR2 / CD264 Protein
Mouse NGFR / P75 Protein (His Tag)TRAILR4 / TNFRSF10D / DCR2 Protein (His Tag)
Mouse NGFR / P75 ProteinCynomolgus TNFRSF10D Protein
NGFR / P75 ProteinCynomolgus TNFRSF10D Protein (His Tag)

All TNF Antibodies

Product nameProduct name
CD137 / 4-1BB Antibody *TNFa Antibody
4-1BBL / TNFSF9 AntibodyTNFa / TNFalpha / TNFSF2 Antibody
4-1BBL / TNFSF9 Antibody *TNFa / TNFalpha / TNFSF2 Antibody *
4-1BBL / TNFSF9 AntibodyTNF-alpha Antibody
4-1BBL / CD137L / TNFSF9 Antibody ( FITC )TNF-alpha Antibody
4-1BBL / CD137L / TNFSF9 Antibody ( PE )TNF-alpha Antibody *
BAFF / TNFSF13B AntibodyTNF-alpha Antibody
BAFF / TNFSF13B Antibody *TNF-alpha Antibody *
CD27 / TNFRSF7 AntibodyTNFA / TNF-alpha Antibody
CD27 / TNFRSF7 Antibody *TNFA / TNF-alpha Antibody
CD27 / TNFRSF7 Antibody ( FITC )TNF-alpha / TNFa Antibody
CD27 / TNFRSF7 Antibody ( FITC )TNF-alpha Antibody ( FITC )
CD27 AntibodyTNF-alpha Antibody ( FITC )
CD27 AntibodyTNF-alpha / TNFa / TNFSF2 Antibody *
CD27 / TNFRSF7 Antibody ( PE )TNFRI / TNFRSF1A / CD120a Antibody
CD27 / TNFRSF7 Antibody ( FITC )TNFR1 / CD120a / TNFRSF1A Antibody *
CD27 AntibodyTNFR1 / CD120a / TNFRSF1A Antibody
CD27 AntibodyTNFRSF1B / TNFR2 / CD120b Antibody
CD27 / TNFRSF7 Antibody ( FITC )TNFRSF1B / TNFR2 / CD120b Antibody *
CD27 / TNFRSF7 Antibody ( PE )TNFRSF1B / TNFR2 / CD120b Antibody
CD40 / TNFRSF5 / Bp50 AntibodyTNFRSF1B / TNFRII / TNFR2 Antibody
CD40 / TNFRSF5 / Bp50 Antibody *TNFR2 / CD120b / TNFRSF1B Antibody
CD40 / TNFRSF5 / Bp50 AntibodyTNFR2 / CD120b / TNFRSF1B Antibody *
CD40 / TNFRSF5 / Bp50 AntibodyTNFR2 / CD120b / TNFRSF1B Antibody
CD40 / TNFRSF5 Antibody ( FITC )Osteoprotegerin / TNFRSF11B Antibody
CD40L / CD154 / TNFSF5 AntibodyTNFRSF19 / TROY Antibody
CD40L / CD154 / TNFSF5 AntibodyTNFRSF19 / TROY Antibody *
FAS / CD95 AntibodyTNFRSF19 / TROY Antibody
FAS / CD95 Antibody * TNFRSF4 / CD134 Antibody
CD95 / Fas / TNFRSF6 AntibodyTNFRSF4 / CD134 Antibody *
CD95 / Fas / TNFRSF6 Antibody * TNFRSF4 / CD134 Antibody
CD95 / APO-1 / TNFRSF6 / FAS AntibodyTNFRSF4 / CD134 Antibody
CD95 / APO-1 / TNFRSF6 / FAS Antibody ( FITC )CD30 / TNFRSF8 Antibody
CD95 / APO-1 / TNFRSF6 / FAS AntibodyCD30 / TNFRSF8 Antibody *
CD95 / APO-1 / TNFRSF6 / FAS Antibody ( PE )CD30 / TNFRSF8 Antibody
CD95 / APO-1 / TNFRSF6 / FAS AntibodyCD30 / TNFRSF8 Antibody
FAS / TNFRSF6 / CD95 AntibodyCD30 / TNFRSF8 Antibody
FAS / TNFRSF6 / CD95 AntibodyCD30 / TNFRSF8 Antibody ( FITC )
CD95 / APO-1 / TNFRSF6 / FAS Antibody ( FITC )CD30 / TNFRSF8 Antibody ( PE )
CD95 / APO-1 / TNFRSF6 / FAS Antibody ( PE )TNFSF10 / TRAIL / APO-2L Antibody *
DR6 / TNFRSF21 AntibodyTRAIL R1 / CD261 / TNFRSF10A Antibody *
DR6 / TNFRSF21 Antibody * TRAIL R1 / CD261 / TNFRSF10A Antibody
DR6 / TNFRSF21 AntibodyTNFRSF10B / TRAILR2 / CD262 Antibody
XEDAR / EDA2R AntibodyTNFRSF10B / TRAILR2 / CD262 Antibody *
XEDAR / EDA2R Antibody *TNFRSF10B / TRAILR2 / CD262 Antibody
XEDAR / EDA2R AntibodyTRAILR2 / TNFRSF10B Antibody
TNF-beta / TNFSF1 alpha Antibody *TRAILR2 / TNFRSF10B Antibody *
TNF-beta / TNFSF1 alpha AntibodyTRAIL R2 / TNFRSF10B / CD262 Antibody
RELT / TNFRSF19L AntibodyTRAIL R2 / TNFRSF10B / CD262 Antibody ( PE )
RELT / TNFRSF19L Antibody *TRAIL R4 / CD264 / TNFRSF10D Antibody
RELT / TNFRSF19L AntibodyTRAIL R4 / CD264 / TNFRSF10D Antibody
TNFa AntibodyTRAIL R4 / CD264 / TNFRSF10D Antibody *
TNFa AntibodyTRAIL R4 / CD264 / TNFRSF10D Antibody
TNFa Antibody* Antigen Affinity Purified
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"