Text Size:AAA

Human TNFA Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TNFacDNA Clone Product Information
Gene Bank Ref.ID:NM_000594.2
cDNA Size:702
cDNA Description:ORF Clone of Homo sapiens tumor necrosis factor (TNF superfamily, member 2) DNA.
Gene Synonym:DIF, TNFA, TNFSF2, TNF-alpha, TNF
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref.ID sequence.
Shipping Carrier:Whatman FTA elute card (Cat: WB120410) contains 5-10 μg of plasmid.
Storage:The Whatman FTA elute card can be stored at room temperature for three months under dry condition.
Human TNFA Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

pCMV/hygro-Myc vector information
Vector Name pCMV/hygro-Myc
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro-Myc Physical Map

Schematic of pCMV/hygro-Myc Multiple Cloning Sites

Myc tag info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Tumor Necrosis Factor (TNF) & Receptor Related Products
Product nameProduct name
Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Canine CD40 / TNFRSF5 Protein (Fc Tag)Canine CD40 / TNFRSF5 Protein (His Tag)Canine CD40 / TNFRSF5 ProteinHuman RELT / TNFRSF19L Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His Tag)Human DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 Protein (His Tag)Human DR6 / TNFRSF21 ProteinRat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Rat TNF-alpha / TNFA ProteinMouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Rat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat TNFSF15 / TL1A Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag) Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat EDAR Protein (Fc Tag)Human TNF-alpha / TNFA ProteinHuman RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 ProteinMouse CD27 / TNFRSF7 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse PGLYRP1 / PGRP-S Protein (His Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinCynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Human TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Human DcR3 / TNFRSF6B Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human Fas Ligand / FASLG / CD95L Protein (His Tag)Cynomolgus TNFSF10 / TRAIL / APO-2L ProteinMouse TNFRSF19 / TROY Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Mouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Cynomolgus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinHuman TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinHuman Osteoprotegerin / TNFRSF11B Protein (His Tag)Cynomolgus CD27 / TNFRSF7 Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus CD40L / CD154 / TNFSF5 Protein (Fc Tag) Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus / Rhesus CD40 / TNFRSF5 Protein (His Tag)Cynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Cynomolgus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Cynomolgus / Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Human TNFRSF11A Protein (Fc Tag)Cynomolgus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human HVEM / TNFRSF14 Protein (His Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human CD30 / TNFRSF8 Protein (His Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human XEDAR / EDA2R Protein (His Tag)Mouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinMouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Human TNFRSF13B / TACI / CD267 Protein (His Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman BLyS / TNFSF13B / BAFF ProteinFerret TNF-alpha / TNFA ProteinMouse XEDAR / EDA2R Protein (Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Canine TNF-alpha / TNFA / TNFSF1A ProteinHuman TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human TNFSF10 / TRAIL / APO-2L / CD253 ProteinHuman TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Human EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)

Tumor necrosis factor alpha (TNF-alpha), also known as TNF, TNFA or TNFSF2, is the prototypic cytokine of the TNF superfamily, and is a multifunctional molecule involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. Two receptors, TNF-R1 (TNF receptor type 1; CD120a; p55/60) and TNF-R2 (TNF receptor type 2; CD120b; p75/80), bind to TNF-alpha. TNF-alpha protein is produced mainly by macrophages, and large amounts of this cytokine are released in response to lipopolysaccharide, other bacterial products, and Interleukin-1 (IL-1). TNF-alpha is involved in fighting against the tumorigenesis, thus, is regarded as a molecular insight in cancer treatment.

TNF-alpha Protein & Antibody

  • Hector J, et al. (2007) TNF-alpha alters visfatin and adiponectin levels in human fat. Horm Metab Res. 39(4): 250-5.
  • Berthold-Losleben M, et al. (2008) The TNF-alpha System: Functional Aspects in Depression, Narcolepsy and Psychopharmacology. Curr Neuropharmacol. 6(3): 193-202.
  • Catalog:HG10602-M-M
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    5 business days
    • Human TNFA Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged