Customer experience is always our first concern. Purchase can be made in your local currency now. Explore our website for more!
Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human TNFa cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human TNFa Gene Plasmid Map
Human TNFα Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Tumor necrosis factor alpha (TNF-alpha), also known as TNF, TNFA or TNFSF2, is the prototypic cytokine of the TNF superfamily, and is a multifunctional molecule involved in the regulation of a wide spectrum of biological processes including cell proliferation, differentiation, apoptosis, lipid metabolism, and coagulation. Two receptors, TNF-R1 (TNF receptor type 1; CD120a; p55/60) and TNF-R2 (TNF receptor type 2; CD120b; p75/80), bind to TNF-alpha. TNF-alpha protein is produced mainly by macrophages, and large amounts of this cytokine are released in response to lipopolysaccharide, other bacterial products, and Interleukin-1 (IL-1). TNF-alpha is involved in fighting against the tumorigenesis, thus, is regarded as a molecular insight in cancer treatment.

TNF-alpha Protein & Antibody

  • Hector J, et al. (2007) TNF-alpha alters visfatin and adiponectin levels in human fat. Horm Metab Res. 39(4): 250-5.
  • Berthold-Losleben M, et al. (2008) The TNF-alpha System: Functional Aspects in Depression, Narcolepsy and Psychopharmacology. Curr Neuropharmacol. 6(3): 193-202.
  • Images
    • Human TNFα Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.