Text Size:AAA

Human TMEFF2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TMEFF2cDNA Clone Product Information
Gene Bank Ref.ID:NM_016192.2
cDNA Size:1125
cDNA Description:ORF Clone of Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 2 DNA.
Gene Synonym:TR, HPP1, TPEF, TENB2, TMEFF2
Species:Human
Vector:pCMV/hygro
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Whatman FTA elute card (Cat: WB120410) contains 5-10 μg of plasmid.
Storage:The Whatman FTA elute card can be stored at room temperature for three months under dry condition.
Image
Human TMEFF2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

pCMV/hygro vector information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Epidermal Growth Factor (EGF) & Receptor Related Products
Product nameProduct name
Rat EGF / Epidermal Growth Factor ProteinHuman NRG1-beta 1 Protein (EGF Domain, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG1-beta 1 Protein (ECD)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Canine NRG1-alpha Protein (ECD, Fc Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)Canine NRG1-alpha Protein (ECD)Cynomolgus HER2 / ErbB2 Protein (ECD, Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Rat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rat HER2 / ErbB2 ProteinMouse Epiregulin / EREG Protein (Fc Tag)Human Amphiregulin / AREG ProteinRat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rat HER4 / ErbB4 Protein (His Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human EGF / Epidermal Growth Factor ProteinCynomolgus HER2 / ErbB2 Protein (His Tag)Human Epiregulin / EREG Protein (Fc Tag) Rat EGFR / HER1 / ErbB1 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Mouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Human HBEGF / DTR ProteinCanine HER2 / ErbB2 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Mouse HER4 / ErbB4 Protein (His Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Human TGFA / TGF-alpha ProteinHuman EGFL6 / EGF-L6 Protein (His Tag)Human EGFL7 / VE-statin Protein (His Tag)Mouse EGFL7 / VE-statin Protein (His Tag)Human NRG4 ProteinHuman BTC / Betacellulin Protein (Fc Tag)Human BTC / Betacellulin Protein (His Tag)Human BTC / Betacellulin ProteinMouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinMouse EGF / Epidermal Growth Factor ProteinMouse LRIG1 / LIG-1 Protein (His Tag)
Background
References
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"