Text Size:AAA

Human TMEFF2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TMEFF2cDNA Clone Product Information
Gene Bank Ref.ID:NM_016192.2
cDNA Size:1125
cDNA Description:ORF Clone of Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 2 DNA.
Gene Synonym:TR, HPP1, TPEF, TENB2, TMEFF2
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Epidermal Growth Factor (EGF) & Receptor Related Products
Product nameProduct name
Human NRG1 Protein (His Tag, ECD)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Mouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinMouse IGFBP-2 / IGFBP2 Protein (His Tag)Mouse IGFBP-2 / IGFBP2 Protein (His Tag)Mouse IGFBP-2 / IGFBP2 Protein (His Tag)Mouse IGFBP-2 / IGFBP2 Protein (His Tag)Influenza A H7N1 (A/turkey/Italy/4602/99) Hemagglutinin / HA1 Protein (His Tag)Mouse IGFBP-2 / IGFBP2 Protein (His Tag)Influenza A H7N1 (A/turkey/Italy/4602/99) Hemagglutinin / HA1 Protein (His Tag)Cynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGF / Epidermal Growth Factor ProteinRat HER2 / ErbB2 ProteinRat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Human BTC / Betacellulin Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Human Epiregulin / EREG Protein (Fc Tag) Mouse EGFL7 / VE-statin Protein (His Tag)Human HBEGF / DTR ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Human Amphiregulin / AREG ProteinHuman / Rhesus HER4 / ErbB4 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Human NRG1-beta 1 Protein (ECD)Mouse HER4 / ErbB4 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Human BTC / Betacellulin Protein (Fc Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinCanine HER2 / ErbB2 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human BTC / Betacellulin ProteinMouse EGF / Epidermal Growth Factor ProteinHuman EGFL6 / EGF-L6 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinCanine NRG1-alpha Protein (ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
  • Human TMEFF2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged