Text Size:AAA

Human TMEFF2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TMEFF2cDNA Clone Product Information
Gene Bank Ref.ID:NM_016192.2
cDNA Size:1125
cDNA Description:ORF Clone of Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 2 DNA.
Gene Synonym:TR, HPP1, TPEF, TENB2, TMEFF2
Species:Human
Vector:pCMV2-FLAG
Restriction Site:KpnI + XhoI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro-FLAG Physical Map
Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Epidermal Growth Factor (EGF) & Receptor Related Products
Product nameProduct name
Human NRG1 Protein (His Tag, ECD)Mouse EGFL6 / EGF-L6 Protein (Fc Tag)Human TMEFF1 / Tomoregulin-1 Protein (Fc Tag, ECD)Human HER2 / ErbB2 ProteinMouse EGF / Epidermal growth factor Protein (His Tag)Rhesus HER3 / ErbB3 ProteinHuman HER3 / ErbB3 ProteinCynomolgus / Rhesus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Human NRG1 Protein (Fc Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human EGF / Epidermal Growth Factor Protein (Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Mouse BTC / Betacellulin Protein (His & Fc Tag)Human HER3 / ErbB3 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human EGF / Epidermal Growth Factor ProteinRat HER2 / ErbB2 ProteinRat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Human BTC / Betacellulin Protein (His Tag)Mouse Epiregulin / EREG Protein (Fc Tag)Human Epiregulin / EREG Protein (Fc Tag) Mouse EGFL7 / VE-statin Protein (His Tag)Human HBEGF / DTR ProteinMouse LRIG1 / LIG-1 Protein (His Tag)Mouse EGF / Epidermal Growth Factor Protein (Fc Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Canine EGF / Epidermal Growth Facto Protein (His Tag)Human NRG1-beta 1 Protein (EGF Domain, Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Human NRG4 ProteinHuman NRG1-alpha Protein (EGF Domain, Fc Tag)Human NRG1-alpha Protein (ECD, Fc Tag)Human NRG1-alpha Protein (ECD, His Tag)Human Amphiregulin / AREG ProteinHuman / Rhesus HER4 / ErbB4 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human NRG1-beta 1 Protein (ECD, Fc Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Human NRG1-beta 1 Protein (ECD)Mouse HER4 / ErbB4 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Human BTC / Betacellulin Protein (Fc Tag)Cynomolgus BTC / Betacellulin Protein (Fc Tag)Mouse EGF / Epidermal Growth Factor ProteinCanine HER2 / ErbB2 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Human HER3 / ErbB3 Protein (Fc Tag)Human BTC / Betacellulin ProteinMouse EGF / Epidermal Growth Factor ProteinHuman EGFL6 / EGF-L6 Protein (His Tag)Rat HER4 / ErbB4 Protein (His Tag)Canine NRG1-alpha Protein (EGF Domain, Fc Tag)Canine NRG1-alpha Protein (ECD, His Tag)Canine NRG1-alpha Protein (ECD, Fc Tag)Human TGFA / TGF-alpha ProteinCanine NRG1-alpha Protein (ECD)Mouse TMEFF1 / Tomoregulin-1 Protein (Fc Tag)Rat EGF / Epidermal Growth Factor ProteinCanine NRG1 Protein (His Tag)
Catalog:HG11006-M-F
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability5 business days
Images
  • Human TMEFF2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
  • Human TMEFF2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"