Text Size:AAA

Human TLR4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TLR4cDNA Clone Product Information
Gene Bank Ref.ID:NM_138554.2
cDNA Size:2520
cDNA Description:ORF Clone of Homo sapiens toll-like receptor 4, transcript variant 1 DNA.
Gene Synonym:TOLL, CD284, hToll, ARMD10
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Whatman FTA elute card (Cat: WB120410) contains 5-10 μg of plasmid.
Storage:The Whatman FTA elute card can be stored at room temperature for three months under dry condition.
Human TLR4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

pCMV/hygro-Myc vector information
Vector Name pCMV/hygro-Myc
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro-Myc Physical Map

Schematic of pCMV/hygro-Myc Multiple Cloning Sites

Myc tag info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

TLR4, also known as TLR-4, is a member of the Toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. TLR4 is most abundantly expressed in placenta, and in myelomonocytic subpopulation of the leukocytes. TLR 4 has also been designated as CD284 (cluster of differentiation 284). It has been implicated in signal transduction events induced by lipopolysaccharide (LPS) found in most gram-negative bacteria. TLR4 Cooperates with LY96 and CD14 to mediate the innate immune response to bacterial lipopolysaccharide (LPS). It acts via MYD88, TIRAP and TRAF6, leading to NF-kappa-B activation, cytokine secretion and the inflammatory response. It is also involved in LPS-independent inflammatory responses triggered by Ni(2+).

  • Re, Fabio, et al. (2002) Monomeric recombinant MD-2 binds toll-like receptor 4 tightly and confers lipopolysaccharide responsiveness. J Biol Chem. 277(26):23427-32.
  • Shimazu, R, et al. (1999) MD-2, a Molecule that Confers Lipopolysaccharide Responsiveness on Toll-like Receptor 4. J Exp Med. 189(11):1777-82.
  • Espevik T, et al. (2010) The Rab11a GTPase controls Toll-like receptor 4-induced activation of interferon regulatory factor-3 on phagosomes. Immunity. 33(4):583-96.
  • Blanco, A M, et al. (2005) Involvement of TLR4/type I IL-1 receptor signaling in the induction of inflammatory mediators and cell death induced by ethanol in cultured astrocytes. Journal of immunology. 175(10):6893-9.