TLR1 / CD281 cDNA ORF Clone, Human, untagged

Cat: HG10151-M-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TLR1 / CD281 Reagents
CRO Services

All TLR1 / CD281 Reagents
TLR1 / CD281 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2361 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human toll-like receptor 1 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TLR1 / CD281 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TLR1 / CD281 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
TLR1 / CD281 cDNA ORF Clone, Human, untagged Alternative Names
CD281 cDNA ORF Clone, Human;rsc786 cDNA ORF Clone, Human;TIL cDNA ORF Clone, Human;TIL.LPRS5 cDNA ORF Clone, Human
TLR1 / CD281 Background Information
Full Name
toll-like receptor 1

TLR1 / CD281 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TLR1 / CD281 cDNA ORF Clone in Cloning Vector, Rhesus CG90255-G
TLR1 / CD281 cDNA ORF Clone, Rhesus, untagged CG90255-UT
TLR1 / CD281 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90255-ACGLN
TLR1 / CD281 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90255-ACG
TLR1 / CD281 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90255-ACR
TLR1 / CD281 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90255-CF
TLR1 / CD281 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90255-NF
TLR1 / CD281 cDNA ORF Clone, Rhesus, C-His tag CG90255-CH
TLR1 / CD281 cDNA ORF Clone, Rhesus, N-His tag CG90255-NH
TLR1 / CD281 cDNA ORF Clone, Rhesus, C-HA tag CG90255-CY
TLR1 / CD281 cDNA ORF Clone, Rhesus, N-HA tag CG90255-NY
TLR1 / CD281 cDNA ORF Clone, Rhesus, C-Myc tag CG90255-CM
TLR1 / CD281 cDNA ORF Clone, Rhesus, N-Myc tag CG90255-NM

TLR1 / CD281 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TLR1 / CD281 cDNA ORF Clone in Cloning Vector, Rat RG80418-G
TLR1 / CD281 cDNA ORF Clone, Rat, untagged RG80418-UT
TLR1 / CD281 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80418-ACG
TLR1 / CD281 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80418-ACGLN
TLR1 / CD281 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80418-ACR
TLR1 / CD281 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80418-CF
TLR1 / CD281 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80418-NF
TLR1 / CD281 cDNA ORF Clone, Rat, C-His tag RG80418-CH
TLR1 / CD281 cDNA ORF Clone, Rat, N-His tag RG80418-NH
TLR1 / CD281 cDNA ORF Clone, Rat, C-HA tag RG80418-CY
TLR1 / CD281 cDNA ORF Clone, Rat, N-HA tag RG80418-NY
TLR1 / CD281 cDNA ORF Clone, Rat, C-Myc tag RG80418-CM
TLR1 / CD281 cDNA ORF Clone, Rat, N-Myc tag RG80418-NM
TLR1 / CD281 qPCR Primer Pairs, Rat RP300382

TLR1 / CD281 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TLR1 / CD281 cDNA ORF Clone in Cloning Vector, Mouse MG50230-M
TLR1 / CD281 cDNA ORF Clone, Mouse, untagged MG50230-UT
TLR1 / CD281 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50230-ACG
TLR1 / CD281 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50230-ACGLN
TLR1 / CD281 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50230-ACR
TLR1 / CD281 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50230-CF
TLR1 / CD281 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50230-NF
TLR1 / CD281 cDNA ORF Clone, Mouse, C-His tag MG50230-CH
TLR1 / CD281 cDNA ORF Clone, Mouse, N-His tag MG50230-NH
TLR1 / CD281 cDNA ORF Clone, Mouse, C-HA tag MG50230-CY
TLR1 / CD281 cDNA ORF Clone, Mouse, N-HA tag MG50230-NY
TLR1 / CD281 cDNA ORF Clone, Mouse, C-Myc tag MG50230-CM
TLR1 / CD281 cDNA ORF Clone, Mouse, N-Myc tag MG50230-NM
TLR1 / CD281 qPCR Primer Pairs, Mouse MP200257

TLR1 / CD281 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TLR1 / CD281 cDNA ORF Clone in Cloning Vector, Human HG10151-M
TLR1 / CD281 cDNA ORF Clone, Human, untagged HG10151-UT
TLR1 / CD281 cDNA ORF Clone, Human, C-GFPSpark® tag HG10151-ACG
TLR1 / CD281 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10151-ACGLN
TLR1 / CD281 cDNA ORF Clone, Human, C-OFPSpark® tag HG10151-ACR
TLR1 / CD281 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10151-CF
TLR1 / CD281 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10151-NF
TLR1 / CD281 cDNA ORF Clone, Human, C-His tag HG10151-CH
TLR1 / CD281 cDNA ORF Clone, Human, N-His tag HG10151-NH
TLR1 / CD281 cDNA ORF Clone, Human, C-HA tag HG10151-CY
TLR1 / CD281 cDNA ORF Clone, Human, N-HA tag HG10151-NY
TLR1 / CD281 cDNA ORF Clone, Human, C-Myc tag HG10151-CM
TLR1 / CD281 cDNA ORF Clone, Human, N-Myc tag HG10151-NM
TLR1 / CD281 qPCR Primer Pairs, Human HP100222
info info
添加购物车成功! 添加购物车失败!