Customer experience is always our first concern. Purchase can be made in your local currency now. Explore our website for more!
Text Size:AAA

Human TGF-beta 1/TGFB1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human TGF-beta 1/TGFB1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human TGF-beta 1/TGFB1 Gene Plasmid Map
Human TGF-beta 1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

TGF-beta 1 is a member of the transforming growth factor beta (TGF-beta) family. The transforming growth factor-beta family of polypeptides are involved in the regulation of cellular processes, including cell division, differentiation, motility, adhesion and death. TGF-beta 1 positively and negatively regulates many other growth factors. It inhibits the secretion and activity of many other cytokines including interferon-γ, tumor necrosis factor-alpha and various interleukins. It can also decrease the expression levels of cytokine receptors. Meanwhile, TGF-beta 1 also increases the expression of certain cytokines in T cells and promotes their proliferation, particularly if the cells are immature. TGF-beta 1 also inhibits proliferation and stimulates apoptosis of B cells, and plays a role in controlling the expression of antibody, transferrin and MHC class II proteins on immature and mature B cells. As for myeloid cells, TGF-beta 1can inhibit their proliferation and prevent their production of reactive oxygen and nitrogen intermediates. However, as with other cell types, TGF-beta 1 also has the opposite effect on cells of myeloid origin. TGF-beta 1 is a multifunctional protein that controls proliferation, differentiation and other functions in many cell types. It plays an important role in bone remodeling as it is a potent stimulator of osteoblastic bone formation, causing chemotaxis, proliferation and differentiation in committed osteoblasts. Once cells lose their sensitivity to TGF-beta1-mediated growth inhibition, autocrine TGF-beta signaling can promote tumorigenesis. Elevated levels of TGF-beta1 are often observed in advanced carcinomas, and have been correlated with increased tumor invasiveness and disease progression.

References
  • Ghadami M, et al. (2000) Genetic Mapping of the Camurati-Engelmann Disease Locus to Chromosome 19q13.1-q13.3. Am J Hum. Genet. 66(1):143-7.
  • Letterio J, et al. (1998) Regulation of immune responses by TGF-beta. Annu Rev Immunol. 16:137-61.
  • Vaughn SP, et al. (2000) Confirmation of the mapping of the Camurati-Englemann locus to 19q13. 2 and refinement to a 3.2-cM region. Genomics. 66(1):119-21.
  • Assoian R, et al. (1983) Transforming growth factor-beta in human platelets. Identification of a major storage site, purification, and characterization. J Biol Chem. 258(11):7155-60.
  • Contact Us
    Images
    • Human TGF-beta 1/TGFB1 Gene Plasmid Map 7353
    • Human TGF-beta 1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"