TFPI cDNA ORF Clone, Human, untagged

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

TFPI cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
915 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TFPI cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TFPI cDNA ORF Clone, Human, untagged: Alternative Names

EPI cDNA ORF Clone, Human; LACI cDNA ORF Clone, Human; TFI cDNA ORF Clone, Human; TFPI1 cDNA ORF Clone, Human

TFPI Background Information

Tissue factor pathway inhibitor (TFPI) is the natural inhibitor of TF coagulant and signaling activities. It is a Kunitz-type serine proteinase inhibitor that down-regulates tissue factor-initiated blood coagulation. With its Kunitz domains, TFPI exhibits significant homology with human inter-alpha-trypson inhibitor and bovin basic pancreatic trypsin inhibitor. TFPI is the natural inhibitor of TF coagulant and signaling activities. The importance of TFPI in the regulation of blood coagulation is emphasized by how its activity is modulated in human disease. In a factor (F) Xa-dependent feedback system, TFPI binds directly and inhibits the TF-FVII/FVIIa complex. Normally, TFPI exists in plasma both as a full-length molecule and as variably carboxy-terminal truncated forms. TFPI also circulates in complex with plasma lipoproteins. The levels and the dual inhibitor effect of TFPI on FXa and TF-FVII/FVIIa complex offers insight into the mechanisms of various pathological conditions triggered by TF. TFPI may play an important role in modulating TF-induced thrombogenesis and it may also provide a unique therapeutic approach for prophylaxis and/or treatment of various diseases. In addition, Studies have shown that TFPI exhibits antiangiogenic and antimetastatic effects in vitro and in vivo. In animal models of experimental metastasis, both circulating and tumor cell-associated TFPI are shown to significantly reduce tumor cell-induced coagulation activation and lung metastasis.
Full Name
tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
References
  • Lwaleed BA, et al. (2006) Tissue factor pathway inhibitor: structure, biology and involvement in disease. J Pathol. 208(3): 327-39.
  • Amirkhosravi A, et al. (2007) The role of tissue factor pathway inhibitor in tumor growth and metastasis. Semin Thromb Hemost. 33(7): 643-52.
  • Maroney SA, et al. (2008) Expression of tissue factor pathway inhibitor by endothelial cells and platelets. Transfus Apher Sci. 38(1): 9-14.
Add to Cart Successfully Add to Cart Failed