_×
Human TFF1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human TFF1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

Human TFF1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG13629-G-H
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

TFF1 cDNA Clone Datasheet

 

TFF1 cDNA Clone Product Information

Gene Bank Ref.ID:

BC032811

cDNA Size:

255

Gene Synonym:

pS2;BCEI;HPS2;HP1.A;pNR-2;D21S21;TFF1

Source: Human

TFF1 cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens trefoil factor 1 DNA.

Vector:

pCMV/hygro-His

His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description: Identical with the Gene Bank Ref.ID sequence.

TFF1 cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

TFF1 cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

TFF1 cDNA Clone Sequence and Quality Control

Sequence:

1        ATGGCCACCA TGGAGAACAA GGTGATCTGC GCCCTGGTCC TGGTGTCCAT GCTGGCCCTC
61       GGCACCCTGG CCGAGGCCCA GACAGAGACG TGTACAGTGG CCCCCCGTGA AAGACAGAAT
121      TGTGGTTTTC CTGGTGTCAC GCCCTCCCAG TGTGCAAATA AGGGCTGCTG TTTCGACGAC
181      ACCGTTCGTG GGGTCCCCTG GTGCTTCTAT CCTAATACCA TCGACGTCCC TCCAGAAGAG
241      GAGTGTGAAT TTGCT1CACCA TCACCACCAT CATCACCACC ATCAC2TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. His Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"