Our new search engine has been launched. Welcome to use it and experience it. If you have any suggestions, welcome to contact us!
Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human SDC4 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human SDC4 Gene Plasmid Map
Human Syndecan-4 / SDC4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

SDC4 (Syndecan-4), also known as Syn4, is a transmembrane heparan sulfate proteoglycan that co-operates with integrins during cell-matrix interactions for the assembly of focal adhesions and actin stress fibers and in the phosphorylation of focal adhesion kinase (FAK) on Tyr397. Syndecan-4 plays roles in the formation of focal adhesions and stress fibers. The cytoplasmic domain of syndecan-4 interacts with a number of signalling and structural proteins, and both extracellular and cytoplasmic domains are necessary for regulated activation of associated transmembrane receptors. Syndecan-4/SDC4 is a heparan sulfate proteoglycan and works as a coreceptor for various growth factors. SDC4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cells (VSMCs) proliferation and vascular progenitor cells (VPCs) mobilization. Therefore, SDC4 may be a novel therapeutic target for preventing arterial restenosis after angioplasty.

  • Ikesue M, et al. (2011) Syndecan-4 deficiency limits neointimal formation after vascular injury by regulating vascular smooth muscle cell proliferation and vascular progenitor cell mobilization. Arterioscler Thromb Vasc Biol. 31(5): 1066-74.
  • Saoncella S, et al. (2004) Syndecan-4 regulates ATF-2 transcriptional activity in a Rac1-dependent manner. J Biol Chem. 279(45): 47172-6.
  • Bass MD, et al. (2002) Cytoplasmic interactions of syndecan-4 orchestrate adhesion receptor and growth factor receptor signalling. Biochem J. 368(Pt 1): 1-15.
  • Couchman JR, et al. (1999) Syndecan-4 and integrins: combinatorial signaling in cell adhesion. J Cell Sci. 112 ( Pt 20): 3415-20.
  • Contact Us
    • Human Syndecan-4 / SDC4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.