Smad1 cDNA ORF Clone, Human, untagged

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

Smad1 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SMAD family member 1 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Smad1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Smad1 cDNA ORF Clone, Human, untagged: Alternative Names

BSP-1 cDNA ORF Clone, Human; BSP1 cDNA ORF Clone, Human; JV4-1 cDNA ORF Clone, Human; JV41 cDNA ORF Clone, Human; MADH1 cDNA ORF Clone, Human; MADR1 cDNA ORF Clone, Human

Smad1 Background Information

SMAD family member 1 (Smad1) have been involved in metastatic progression of many cancer types. Smad1 is an important mediator of the bone morphogenetic protein (BMP)/Smad pathway. It was indicated that the BMP/Smad pathway is attenuated and the transforming growth factorbeta/activin pathway is promoted by Smad1 reduction.
Full Name
SMAD family member 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait