Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-HA tag

Cat: VG40343-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SFTSV Non-structural protein Reagents
CRO Services
Product recommended

All SFTSV Non-structural protein Reagents
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-HA tag General Information
Gene
Species
SFTSV
NCBI Ref Seq
RefSeq ORF Size
924 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+0.92kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SFTSV Non-structural protein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612

SFTSV Non-structural protein cDNA ORF Clone, SFTSV, Related Products

Product Name Catalog#(PDF)
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid VG40343-G
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs natural ORF mammalian expression plasmid VG40343-UT
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-GFPSpark tag VG40343-ACG
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40343-ACGLN
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-GFPSpark tag VG40343-ANG
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40343-ACR
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40343-ANR
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-tagged VG40343-CF
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-Flag tag VG40343-NF
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-His tag VG40343-CH
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-His tag VG40343-NH
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-HA tag VG40343-NY
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-Myc tag VG40343-CM
Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-Myc tag VG40343-NM
info info
添加购物车成功! 添加购物车失败!