Quick Order

Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    SFTSV SFTSV-NSs cDNA Clone Product Information
    NCBI RefSeq:KC505125.1
    RefSeq ORF Size:882bp
    cDNA Description:Full length Clone DNA of Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs with N terminal His tag.
    Gene Synonym:SFTSV-NSs
    Species:SFTSV
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-His tag on other vectors
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-GFPSpark tagVG40343-ACG$325
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40343-ACR$325
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-GFPSpark tagVG40343-ANG$325
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40343-ANR$325
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40343-CF$295
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-His tagVG40343-CH$295
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-Myc tagVG40343-CM$295
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, C-HA tagVG40343-CY$295
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid (Codon Optimized)VG40343-G$95
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-Flag tagVG40343-NF$295
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-His tagVG40343-NH$295
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-Myc tagVG40343-NM$295
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs ORF mammalian expression plasmid, N-HA tagVG40343-NY$295
    Severe fever with thrombocytopenia syndrome bunyavirus (SFTSV) (isolate JS2011-004) NSs natural ORF mammalian expression plasmidVG40343-UT$295
     Learn more about expression Vectors
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"