After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human SerpinE1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SERPINE1 cDNA Clone Product Information
NCBI RefSeq:NM_000602.3
RefSeq ORF Size:1209bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade E(nexin,plasminogen activator inhibitor type 1), member 1.
Gene Synonym:PAI, PAI1, PAI-1, PLANH1
Restriction Site:KpnI + XhoI (5.5kb + 1.21kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Plasminogen activator inhibitor 1, also known as PAI-1, Endothelial plasminogen activator inhibitor, SerpinE1 and PLANH1, is a secreted glycoprotein which belongs to the serpin family. SerpinE1 is the primary physiological inhibitor of the two plasminogen activators urokinase (uPA) and tissue plasminogen activator (tPA). Its rapid interaction with TPA may function as a major control point in the regulation of fibrinolysis. Defects in SerpinE1 are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency) which is characterized by abnormal bleeding due to SerpinE1 defect in the plasma. High concentrations of SerpinE1 have been associated with thrombophilia which is an autosomal dominant disorder in which affected individuals are prone to develop serious spontaneous thrombosis. Studies of PAI-1 have contributed significantly to the elucidation of the protease inhibitory mechanism of serpins, which is based on a metastable native state becoming stabilised by insertion of the RCL into the central beta-sheet A and formation of covalent complexes with target proteases. Greater expression of PAI-1 has been associated with increased survival of cells and resistance to apoptosis. PAI-1 appears to influence apoptosis by decreasing cell adhesion (anoikis) as well as its effect on intracellular signaling. PAI-1, in its active state, also binds to the extracellular protein vitronectin. When in complex with its target proteases, it binds with high affinity to endocytosis receptors of the low density receptor family. The mechanisms of PAI-1 overexpression during obesity are complex, and it is conceivable that several inducers are involved at the same time at several sites of synthesis. PAI-1 is also implicated in adipose tissue development. It suggests that PAI-1 inhibitors serve in the control of atherothrombosis.

  • Alessi MC, et al. (2006) PAI-1 and the metabolic syndrome: links, causes, and consequences. Arterioscler Thromb Vasc Biol. 26(10): 2200-7.
  • Schneider DJ, et al. (2008) The effect of plasminogen activator inhibitor type 1 on apoptosis. Thromb Haemost. 100(6): 1037-40.
  • Dupont DM, et al. (2009) Biochemical properties of plasminogen activator inhibitor-1. Front Biosci. 14: 1337-61.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.