Quick Order

Text Size:AAA

Human SerpinD1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SERPIND1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for a point mutation 1446 T/C not resulting in the any amino acid variation.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

SerpinD1, also known as heparin cofactor II (HCâ…¡), is a member of Serpin superfamily of the serine proteinase inhibitors. HCII is a glycoprotein in human plasma that inhibits thrombin and chymotrypsin, and the rate of inhibition of thrombin is rapidly increased by Dermatan sulfate (DS), heparin (H) and glycosaminoglycans(GAG). The stimulatory effect of glycosaminoglycans on the inhibition is mediated, in part, by the N-terminal acidic domain of HCII. Interestingly, a C-terminal His-tagged recombinant HCII exhibits enhanced activity of thrombin inhibition. It has been suggested that HCII plays an unique and important role in vascular homeostasis, and accordingly mutations in this gene or congenital HCII deficiency is potentially associated with thrombosis. HCII specifically inhibits thrombin action at the site of vascular wall injury and HCII-thrombin complexes have been detected in human plasma. HCII protects against thrombin-induced vascular remodeling in both humans and mice and suggest that HCII is a predictive biomarker and therapeutic target for atherosclerosis. SerpinD1 also inhibits chymotrypsin, but in a glycosaminoglycan-independent manner.

  • Rau JC, et al. (2009) Heparin cofactor II in atherosclerotic lesions from the Pathobiological Determinants of Atherosclerosis in Youth (PDAY) study. Exp Mol Pathol. 87(3): 178-83.
  • Aihara K, et al. (2009) Heparin cofactor II as a novel vascular protective factor against atherosclerosis. J Atheroscler Thromb. 16(5): 523-31.
  • Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.