After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SULT2A1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SULT2A1 cDNA Clone Product Information
NCBI RefSeq:NM_003167.3
RefSeq ORF Size:858bp
cDNA Description:Full length Clone DNA of Homo sapiens sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1.
Gene Synonym:HST, ST2, STD, hSTa, DHEAS, ST2A3, DHEA-ST, SULT2A1
Restriction Site:KpnI + XbaI (5.5kb + 0.86kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 90T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SULT2A1 Gene Plasmid Map
Human SULT2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Hydroxysteroid sulfotransferase ( SULT2A1 ) is a key enzyme in the testicular and hepatic metabolism of 5alpha-androstenone, which is a major component of the off-odor and off-flavor in pork known as boar taint. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. SULT2A1 is a sulfo-conjugating phase II enzyme expressed at very high levels in the liver and intestine, the two major first-pass metabolic tissues, and in the steroidogenic adrenal tissue. SULT2A1 acts preferentially on the hydroxysteroids dehydroepiandrosterone, testosterone/dihydrotestosterone, and pregnenolone and on cholesterol-derived amphipathic sterol bile acids.

  • Chatterjee, B. 2005, Methods Enzymol. 400:165-91.
  • Liu,Y. et al., 2006, Chem Res Toxicol. 19 (11):1420-5.
  • Sinclair, PA. et al., 2006, J Mol Endocrinol  36 (2):301-11.
  • Yalcin, EB. et al., 2008, Drug Metab Lett  2 (3):198-204.
  • Size / Price
    Catalog: HG11411-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.