SULT2A1 cDNA ORF Clone, Human, untagged

Cat: HG11411-M-N
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SULT2A1 Reagents
CRO Services

All SULT2A1 Reagents
SULT2A1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
858 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 90T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XbaI (5.5kb + 0.86kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SULT2A1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SULT2A1 cDNA ORF Clone, Human, untagged Validated Images
Human SULT2A1 Gene Plasmid Map 7436
SULT2A1 cDNA ORF Clone, Human, untagged Alternative Names
DHEA-ST cDNA ORF Clone, Human;DHEAS cDNA ORF Clone, Human;HST cDNA ORF Clone, Human;hSTa cDNA ORF Clone, Human;ST2 cDNA ORF Clone, Human;ST2A1 cDNA ORF Clone, Human;ST2A3 cDNA ORF Clone, Human;STD cDNA ORF Clone, Human
SULT2A1 Background Information

Hydroxysteroid sulfotransferase ( SULT2A1 ) is a key enzyme in the testicular and hepatic metabolism of 5alpha-androstenone, which is a major component of the off-odor and off-flavor in pork known as boar taint. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. SULT2A1 is a sulfo-conjugating phase II enzyme expressed at very high levels in the liver and intestine, the two major first-pass metabolic tissues, and in the steroidogenic adrenal tissue. SULT2A1 acts preferentially on the hydroxysteroids dehydroepiandrosterone, testosterone/dihydrotestosterone, and pregnenolone and on cholesterol-derived amphipathic sterol bile acids.

Full Name
sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1
References
  • Chatterjee, B. 2005, Methods Enzymol. 400:165-91.
  • Liu,Y. et al., 2006, Chem Res Toxicol. 19 (11):1420-5.
  • Sinclair, PA. et al., 2006, J Mol Endocrinol  36 (2):301-11.
  • Yalcin, EB. et al., 2008, Drug Metab Lett  2 (3):198-204.
  • info info
    添加购物车成功! 添加购物车失败!