Text Size:AAA

Human SULT2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SULT2A1cDNA Clone Product Information
Gene Bank Ref.ID:NM_003167.3
cDNA Size:858
cDNA Description:ORF Clone of Homo sapiens sulfotransferase family, cytosolic, 2A, dehydroepiandrosterone (DHEA)-preferring, member 1 DNA.
Gene Synonym:HST, ST2, STD, hSTa, DHEAS, ST2A3, DHEA-ST, SULT2A1
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 90T/C not causing the amino acid variation.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Hydroxysteroid sulfotransferase ( SULT2A1 ) is a key enzyme in the testicular and hepatic metabolism of 5alpha-androstenone, which is a major component of the off-odor and off-flavor in pork known as boar taint. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. SULT2A1 is a sulfo-conjugating phase II enzyme expressed at very high levels in the liver and intestine, the two major first-pass metabolic tissues, and in the steroidogenic adrenal tissue. SULT2A1 acts preferentially on the hydroxysteroids dehydroepiandrosterone, testosterone/dihydrotestosterone, and pregnenolone and on cholesterol-derived amphipathic sterol bile acids.

  • Chatterjee, B. 2005, Methods Enzymol. 400:165-91.
  • Liu,Y. et al., 2006, Chem Res Toxicol. 19 (11):1420-5.
  • Sinclair, PA. et al., 2006, J Mol Endocrinol  36 (2):301-11.
  • Yalcin, EB. et al., 2008, Drug Metab Lett  2 (3):198-204.
  • Catalog:HG11411-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human SULT2A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged