Our new search engine has been launched. Welcome to use it and experience it. If you have any suggestions, welcome to contact us!
Text Size:AAA

Human SULT1E1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SULT1E1 cDNA Clone Product Information
NCBI RefSeq:NM_005420.2
RefSeq ORF Size:885bp
cDNA Description:Full length Clone DNA of Homo sapiens sulfotransferase family 1E, estrogen-preferring, member 1.
Gene Synonym:EST, STE, EST-1, MGC34459, SULT1E1
Restriction Site:KpnI + XbaI (5.5kb + 0.89kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SULT1E1 Gene Plasmid Map
Human SULT1E1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Estrogen sulfotransferase, also known as Sulfotransferase, estrogen-preferring, Sulfotransferase 1E1, SULT1E1 and ST1E1, is a cytoplasm enzyme which belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. SULT1E1 may control the level of the estrogen receptor by sulfurylating free estradiol. SULT1E1 maximally sulfates beta-estradiol and estrone at concentrations of 20 nM. SULT1E1 also sulfates dehydroepiandrosterone, pregnenolone, ethinylestradiol, equalenin, diethylstilbesterol and 1-naphthol, at significantly higher concentrations; however, cortisol, testosterone and dopamine are not sulfated. SULT1E1 is a key enzyme in estrogen homeostasis. It plays a central role in the prevention and development of human disease.

  • Bernier F, et al.,1994, J Biol Chem. 269 (45): 28200-5.
  • Strausberg RL, et al.,2003, Proc. Natl. Acad. Sci. 99 (26): 16899-903.
  • Cole,GB. et al., 2010, Proc Natl Acad Sci USA. 107 (14): 6222-7.
  • Size / Price
    Catalog: HG11275-M-N
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human SULT1E1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.