Text Size:AAA

Human SULT1E1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SULT1E1cDNA Clone Product Information
Gene Bank Ref.ID:NM_005420.2
cDNA Size:885
cDNA Description:ORF Clone of Homo sapiens sulfotransferase family 1E, estrogen-preferring, member 1 DNA.
Gene Synonym:EST, STE, EST-1, MGC34459, SULT1E1
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

Estrogen sulfotransferase, also known as Sulfotransferase, estrogen-preferring, Sulfotransferase 1E1, SULT1E1 and ST1E1, is a cytoplasm enzyme which belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. SULT1E1 may control the level of the estrogen receptor by sulfurylating free estradiol. SULT1E1 maximally sulfates beta-estradiol and estrone at concentrations of 20 nM. SULT1E1 also sulfates dehydroepiandrosterone, pregnenolone, ethinylestradiol, equalenin, diethylstilbesterol and 1-naphthol, at significantly higher concentrations; however, cortisol, testosterone and dopamine are not sulfated. SULT1E1 is a key enzyme in estrogen homeostasis. It plays a central role in the prevention and development of human disease.

  • Bernier F, et al.,1994, J Biol Chem. 269 (45): 28200-5.
  • Strausberg RL, et al.,2003, Proc. Natl. Acad. Sci. 99 (26): 16899-903.
  • Cole,GB. et al., 2010, Proc Natl Acad Sci USA. 107 (14): 6222-7.
  • Catalog:HG11275-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human SULT1E1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged