Customer experience is always our first concern. Purchase can be made in your local currency now. Explore our website for more!
Text Size:AAA

Human STAT3 transcript variant 1 ORF mammalian expression plasmid, His tag

DatasheetReviewsRelated ProductsProtocols
Human STAT3 cDNA Clone Product Information
NCBI RefSeq:NM_139276.2
RefSeq ORF Size:2313bp
cDNA Description:Full length Clone DNA of Homo sapiens signal transducer and activator of transcription 3 (acute-phase response factor), transcript variant 1 with His tag.
Gene Synonym:STAT3, APRF
Species:Human
Vector:pCMV/hygro-His
Plasmid:pCMV-STAT3-10his
Restriction Site:HindIII + XhoI (5.5kb + 2.34kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human STAT3 Gene Plasmid Map
Human STAT3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Size / Price
Catalog: HG10034-M-H
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock
 Shipping instructions
Images
  • Human STAT3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"