HAI-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10324-M-F

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HAI-2 Reagents
CRO Services

All HAI-2 Reagents
HAI-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
759 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serine peptidase inhibitor, Kunitz type, 2 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 0.81kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
HAI-2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HAI-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
DIAR3 cDNA ORF Clone, Human;HAI-2 cDNA ORF Clone, Human;HAI2 cDNA ORF Clone, Human;Kop cDNA ORF Clone, Human;PB cDNA ORF Clone, Human
HAI-2 Background Information
Full Name
serine peptidase inhibitor, Kunitz type, 2

HAI-2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HAI-2 cDNA ORF Clone in Cloning Vector, Mouse MG50042-U
HAI-2 cDNA ORF Clone, Mouse, untagged MG50042-UT
HAI-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50042-ACGLN
HAI-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50042-ACG
HAI-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50042-ACR
HAI-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50042-CF
HAI-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50042-NF
HAI-2 cDNA ORF Clone, Mouse, C-His tag MG50042-CH
HAI-2 cDNA ORF Clone, Mouse, N-His tag MG50042-NH
HAI-2 cDNA ORF Clone, Mouse, C-HA tag MG50042-CY
HAI-2 cDNA ORF Clone, Mouse, N-HA tag MG50042-NY
HAI-2 cDNA ORF Clone, Mouse, C-Myc tag MG50042-CM
HAI-2 cDNA ORF Clone, Mouse, N-Myc tag MG50042-NM
HAI-2 qPCR Primer Pairs, Mouse MP200042

HAI-2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HAI-2 cDNA ORF Clone in Cloning Vector, Human HG10324-M
HAI-2 cDNA ORF Clone, Human, untagged HG10324-UT
HAI-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10324-ACG
HAI-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10324-ACGLN
HAI-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10324-ACR
HAI-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10324-CF
HAI-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10324-NF
HAI-2 cDNA ORF Clone, Human, C-His tag HG10324-CH
HAI-2 cDNA ORF Clone, Human, N-His tag HG10324-NH
HAI-2 cDNA ORF Clone, Human, C-HA tag HG10324-CY
HAI-2 cDNA ORF Clone, Human, N-HA tag HG10324-NY
HAI-2 cDNA ORF Clone, Human, C-Myc tag HG10324-CM
HAI-2 cDNA ORF Clone, Human, N-Myc tag HG10324-NM
HAI-2 qPCR Primer Pairs, Human HP100364
info info
添加购物车成功! 添加购物车失败!