Quick Order

Text Size:AAA

Human SPEG/APEG-1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SPEG cDNA Clone Product Information
NCBI RefSeq:NM_001173476.1
RefSeq ORF Size:342bp
cDNA Description:Full length Clone DNA of Homo sapiens SPEG complex locus.
Gene Synonym:BPEG, APEG1, APEG-1, SPEGbeta, SPEGalpha
Restriction Site:KpnI + XhoI (5.5kb + 0.34kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SPEG Gene Plasmid Map
Human SPEG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human SPEG/APEG-1 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name

Striated muscle preferentially expressed protein kinase, also known as aortic preferentially expressed protein 1, APEG-1, SPEG and KIAA1297, is a protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. SPEG / APEG-1 contains two fibronectin type-III domains, nine Ig-like (immunoglobulin-like) domains, two protein kinase domains. Isoform 1 of SPEG is preferentially expressed in striated muscle. Non-kinase form such as isoform 3 of SPEG is predominantly expressed in the aorta. Isoform 3 of SPEG appears to be expressed only in highly differentiated ASMC in normal vessel walls and down-regulated in dedifferentiated ASMC. Isoform 3 of SPEG may have a role in regulating the growth and differentiation of arterial smooth muscle cells. Isoform 3 of SPEG is quickly down-regulated in response to vascular injury, when ASMC cells change from a quiescent to a proliferative phenotype.

  • Hsieh C.-M., et al., 1996, J. Biol. Chem. 271:17354-17359.
  • Manjasetty B.A., et al., 2005, BMC Struct. Biol. 5:21-21.
  • Zhou,Y. et al., 2007, Anal Chem. 79 (15): 5826-37.
  • Greenman C., et al., 2007, Nature. 446:153-158.
  • Size / Price
    Catalog: HG12472-G-N
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human SPEG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.