Customer experience is always our first concern. Purchase can be made in your local currency now. Explore our website for more!
Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human SNCA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human SNCA Gene Plasmid Map
Human SNCA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Alpha-Synuclein (alpha-Syn), also known as NACP or SNCA, exists as at least two structural isoforms: one is helix-rich, membrane-bound form that both the N- and C-terminal regions of alpha-synuclein are tightly associated with membranes and the other is disordered, cytosolic form. Synuclein is found predominantly in the presynaptic termini, in both free or membrane-bound forms. SNCA is extensively localized in nucleus of neurons. It has been shown that alpha-Synuclein was highly expressed in the mitochondria in olfactory bulb, hippocampus, striatum, and thalamus, where the cytosolic alpha-Synuclein was also rich. Normally the unstructured soluble type of alpha-synuclein can aggregate to form insoluble fibrils in pathological conditions characterized by Lewy bodies, such as Parkinson's disease, dementia with Lewy bodies and multiple system atrophy. SNCA abnormality and mitochondrial deficiency are two major changes in the brain of patients with Parkinson's disease (PD). In addition, alpha-synuclein is an abundant component of Lewy bodies in sporadic Parkinson's disease and diffuse Lewy body disease.

References
  • Arima K, et al. (1998) Immunoelectron-microscopic demonstration of NACP / alpha-synuclein-epitopes onthe filamentous component of Lewy bodies in Parkinson's disease and in dementia with Lewy bodies. Brain Res. 808 (1): 93-100.
  • Arima K, et al. (1998) NACP / alpha-synuclein immunoreactivity in fibrillary components of neuronal and oligodendroglial cytoplasmic inclusions in the pontine nuclei in multiple system atrophy. Acta Neuropathol. 96 (5): 439-44.
  • Lee HJ, et al. (2001) Membrane-bound alpha-Synuclein Has a High Aggregation Propensity and the Ability to Seed the Aggregation of the Cytosolic Form. The Journal of Biological Chemistry. 277: 671-8.
  • Images
    • Human SNCA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"