Acid sphingomyelinase / SMPD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

Acid sphingomyelinase / SMPD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1896 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human sphingomyelin phosphodiesterase 1, acid lysosomal with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XbaI (5.4kb + 1.95kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Acid sphingomyelinase / SMPD1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Acid sphingomyelinase / SMPD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

ASM cDNA ORF Clone, Human; ASMASE cDNA ORF Clone, Human; NPD cDNA ORF Clone, Human

Acid sphingomyelinase / SMPD1 Background Information

Sphingomyelin phosphodiesterase 1 (SMPD1) , also known as ASM ( acid sphingomyelinase ), is a member of the acid sphingomyelinase family of enzymes. Three isoforms have been identified, isoform 1 is 631 amino acids (aa) in length as the pro form, while Isoform 2 and isoform 3 have lost catalytic activity. The active SMPD1 isoform 1 contains one saposin B-type domain that likely interacts with sphingomyelin, and a catalytic region. Human SMPD1 is 86% aa identical to mouse SMPD1. SMPD1 is a monomeric lysosomal enzyme that converts sphingomyelin (a plasma membrane lipid ) into ceramide through the removal of phosphorylcholine. This generates second messenger components that participate in signal transduction. Defects in SMPD1 are the cause of Niemann-Pick disease type A (NPA) and type B (NPB), also known as Niemann-Pick disease classical infantile form and Niemann-Pick disease visceral form. Niemann-Pick disease is a clinically and genetically heterogeneous recessive disorder. NPB has little if any neurologic involvement and patients may survive into adulthood.
Full Name
sphingomyelin phosphodiesterase 1
References
  • Schuchman E.H., et al.,(1991), Human acid sphingomyelinase. Isolation, nucleotide sequence and expression of the full-length and alternatively spliced cDNAs. J. Biol. Chem. 266:8531-8539.
  • Newrzella D., et al., (1992), Molecular cloning of the acid sphingomyelinase of the mouse and the organization and complete nucleotide sequence of the gene.Biol. Chem. Hoppe-Seyler 373:1233-1238.
  • Schuchman E.H., et al.,(1992), Structural organization and complete nucleotide sequence of the gene encoding human acid sphingomyelinase (SMPD1).Genomics 12:197-205.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait