Quick Order

Human Smad5 Gene ORF cDNA clone expression plasmid

  • Human SMAD5 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human Smad5 cDNA Clone Product Information
NCBI RefSeq:NM_001001420.1
RefSeq ORF Size:1398bp
cDNA Description:Full length Clone DNA of Homo sapiens SMAD family member 5 (SMAD5), transcript variant 3.
Gene Synonym:Smad5, Dwfc, JV5-1, MADH5, DKFZp781C1895
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-smad5
Restriction Site:KpnI + XhoI (5.5kb + 1.4kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with Smad5 qPCR primers for gene expression analysis, HP100114 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Smad5 Gene Plasmid Map
Human SMAD5 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

SMAD5 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD5 is involved in the TGF-beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. It is also involved in cell signalling and modulates signals of bone morphogenetic proteins (BMP's). The binding of ligands causes the oligomerization and phosphorylation of the SMAD5 protein. SMAD5 is a receptor regulated SMAD (R-SMAD) and is activated by bone morphogenetic protein type 1 receptor kinase.

References
  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Sangadala S. et al., 2007, J Biomol Struct Dyn. 25 (1): 11-23.
  • Riggins GJ. et al., 1996, Nat Genet. 13 (3): 347-9.
  • Size / Price
    Catalog: HG10017-M-N
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"