Quick Order

Text Size:AAA

Human SMAD5 transcript variant 3 ORF mammalian expression plasmid, Flag tag

DatasheetReviewsRelated ProductsProtocols
Human Smad5 cDNA Clone Product Information
NCBI RefSeq:NM_001001420.1
RefSeq ORF Size:1398bp
cDNA Description:Full length Clone DNA of Homo sapiens SMAD family member 5 (SMAD5), transcript variant 3 with Flag tag.
Gene Synonym:Smad5, Dwfc, JV5-1, MADH5, DKFZp781C1895
Species:Human
Vector:pCMV/hygro-FLAG
Plasmid:pCMV-smad5-flag
Restriction Site:KpnI + XhoI (5.5kb + 1.43kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human Smad5 Gene Plasmid Map
Human SMAD5 transcript variant 3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

SMAD5 is a member of the SMAD family. Members of this family mediate signal transduction by the TGF-beta/activin/BMP-2/4 cytokine superfamily from receptor Ser/Thr protein kinases at the cell surface to the nucleus. SMAD5 is involved in the TGF-beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. It is also involved in cell signalling and modulates signals of bone morphogenetic proteins (BMP's). The binding of ligands causes the oligomerization and phosphorylation of the SMAD5 protein. SMAD5 is a receptor regulated SMAD (R-SMAD) and is activated by bone morphogenetic protein type 1 receptor kinase.

References
  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Sangadala S. et al., 2007, J Biomol Struct Dyn. 25 (1): 11-23.
  • Riggins GJ. et al., 1996, Nat Genet. 13 (3): 347-9.
  • Size / Price
    Catalog: HG10017-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"