SIRP alpha cDNA ORF Clone, Mouse, untagged

Cat: MG50956-G-N

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SIRP alpha Reagents

CRO Services


All SIRP alpha Reagents

SIRP alpha cDNA ORF Clone, Mouse, untagged General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1530 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 459 A/G not causing the amino acid variation.
Description
Full length Clone DNA of Mouse signal-regulatory protein alpha DNA.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
NheI + XbaI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SIRP alpha cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SIRP alpha cDNA ORF Clone, Mouse, untagged Validated Images

Human BCL2L1/Bcl-XL Gene Plasmid Map 7278

SIRP alpha cDNA ORF Clone, Mouse, untagged Alternative Names

AI835480 cDNA ORF Clone, Mouse;Bit cDNA ORF Clone, Mouse;CD172a cDNA ORF Clone, Mouse;P84 cDNA ORF Clone, Mouse;Ptpns1 cDNA ORF Clone, Mouse;SHP-1 cDNA ORF Clone, Mouse;SHPS-1 cDNA ORF Clone, Mouse;SIRP cDNA ORF Clone, Mouse

SIRP alpha Background Information

Tyrosine-protein phosphatase non-receptor type substrate 1, also known as SHP substrate 1, Inhibitory receptor SHPS-1, Brain Ig-like molecule with tyrosine-based activation motifs, Macrophage fusion receptor, CD172 antigen-like family member A, SIRPA and CD172a, is a single-pass type I membrane protein which contains two Ig-like C1-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. SIRPA is ubiquitously expressed. It is highly expressed in brain and detected at lower levels in heart, placenta, lung, testis, ovary, colon, liver, small intestine, prostate, spleen, kidney, skeletal muscle and pancreas. It is also detected on myeloid cells, but not T-cells. SIRPA is an immunoglobulin-like cell surface receptor for CD47. SIRPA acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. SIRPA supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. It may play a key role in intracellular signaling during synaptogenesis and in synaptic function. SIRPA is involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. It mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation.

Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: IP Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
signal-regulatory protein alpha
References
  • Timms JF. et al., 1999, Curr Biol. 9: 927-30.
  • Stofega MR. et al., 2000, J Biol Chem. 275: 28222-9.
  • Liu T. et al., 2005, J Proteome Res. 4: 2070-80.
  • Wolf-Yadlin A. et al., 2007, Proc Natl Acad Sci. 104: 5860-5.
  • SIRP alpha cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SIRP alpha cDNA ORF Clone in Cloning Vector, Rat RG80270-G
    SIRP alpha cDNA ORF Clone, Rat, untagged RG80270-UT
    SIRP alpha cDNA ORF Clone, Rat, C-GFPSpark® tag RG80270-ACG
    SIRP alpha Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80270-ACGLN
    SIRP alpha cDNA ORF Clone, Rat, C-OFPSpark® tag RG80270-ACR
    SIRP alpha cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80270-CF
    SIRP alpha cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80270-NF
    SIRP alpha cDNA ORF Clone, Rat, C-His tag RG80270-CH
    SIRP alpha cDNA ORF Clone, Rat, N-His tag RG80270-NH
    SIRP alpha cDNA ORF Clone, Rat, C-HA tag RG80270-CY
    SIRP alpha cDNA ORF Clone, Rat, N-HA tag RG80270-NY
    SIRP alpha cDNA ORF Clone, Rat, C-Myc tag RG80270-CM
    SIRP alpha cDNA ORF Clone, Rat, N-Myc tag RG80270-NM
    SIRP alpha qPCR Primer Pairs, Rat RP300388

    SIRP alpha cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SIRP alpha cDNA ORF Clone in Cloning Vector, Mouse MG50956-G
    SIRP alpha cDNA ORF Clone, Mouse, untagged MG50956-UT
    SIRP alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50956-ACGLN
    SIRP alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50956-ACG
    SIRP alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50956-ACR
    SIRP alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50956-CF
    SIRP alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50956-NF
    SIRP alpha cDNA ORF Clone, Mouse, C-His tag MG50956-CH
    SIRP alpha cDNA ORF Clone, Mouse, N-His tag MG50956-NH
    SIRP alpha cDNA ORF Clone, Mouse, C-HA tag MG50956-CY
    SIRP alpha cDNA ORF Clone, Mouse, N-HA tag MG50956-NY
    SIRP alpha cDNA ORF Clone, Mouse, C-Myc tag MG50956-CM
    SIRP alpha cDNA ORF Clone, Mouse, N-Myc tag MG50956-NM
    SIRP alpha qPCR Primer Pairs, Mouse MP200925

    SIRP alpha cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SIRP alpha cDNA ORF Clone in Cloning Vector, Human HG11612-M
    SIRP alpha cDNA ORF Clone, Human, untagged HG11612-UT
    SIRP alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11612-ACGLN
    SIRP alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG11612-ACG
    SIRP alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG11612-ACR
    SIRP alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11612-CF
    SIRP alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11612-NF
    SIRP alpha cDNA ORF Clone, Human, C-His tag HG11612-CH
    SIRP alpha cDNA ORF Clone, Human, N-His tag HG11612-NH
    SIRP alpha cDNA ORF Clone, Human, C-HA tag HG11612-CY
    SIRP alpha cDNA ORF Clone, Human, N-HA tag HG11612-NY
    SIRP alpha cDNA ORF Clone, Human, C-Myc tag HG11612-CM
    SIRP alpha cDNA ORF Clone, Human, N-Myc tag HG11612-NM
    SIRP alpha qPCR Primer Pairs, Human HP101439
    info info
    添加购物车成功! 添加购物车失败!