Quick Order

Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SHC1/SHCA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:
Storage:
Human SHC1/SHCA Gene Plasmid Map
Human SHC1 / SHCA transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10036-ACG$225
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10036-ACR$225
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10036-ANG$225
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10036-ANR$225
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10036-CF$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG10036-CH$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10036-CM$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG10036-CY$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10036-M$75
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10036-M-F$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10036-NF$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG10036-NH$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10036-NM$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG10036-NY$195
Human SHC1/SHCA transcript variant 2 Gene ORF cDNA clone expression plasmidHG10036-UT$195
 Learn more about expression Vectors
Product nameProduct name
Contact Us
Images
  • Human SHC1 / SHCA transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"