_×
Human KIT Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human KIT Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Human KIT Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG11996-G-F
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

KIT cDNA Clone Datasheet

 

KIT cDNA Clone Product Information

Gene Bank Ref.ID:

NM_001093772.1

cDNA Size:

2919

Gene Synonym:

PBT; SCFR; C-Kit; CD117; KIT

Source: Human

KIT cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog DNA.

Vector:

pCMV/hygro-FLAG

FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description: Identical with the Gene Bank Ref. ID sequence.

KIT cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

KIT cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

KIT cDNA Clone Sequence and Quality Control

Sequence:

1        ATGAGAGGCG CTCGCGGCGC CTGGGATTTT CTCTGCGTTC TGCTCCTACT GCTTCGCGTC
61       CAGACAGGCT CTTCTCAACC ATCTGTGAGT CCAGGGGAAC CGTCTCCACC ATCCATCCAT
121      CCAGGAAAAT CAGACTTAAT AGTCCGCGTG GGCGACGAGA TTAGGCTGTT ATGCACTGAT
181      CCGGGCTTTG TCAAATGGAC TTTTGAGATC CTGGATGAAA CGAATGAGAA TAAGCAGAAT
241      GAATGGATCA CGGAAAAGGC AGAAGCCACC AACACCGGCA AATACACGTG CACCAACAAA
301      CACGGCTTAA GCAATTCCAT TTATGTGTTT GTTAGAGATC CTGCCAAGCT TTTCCTTGTT
361      GACCGCTCCT TGTATGGGAA AGAAGACAAC GACACGCTGG TCCGCTGTCC TCTCACAGAC
421      CCAGAAGTGA CCAATTATTC CCTCAAGGGG TGCCAGGGGA AGCCTCTTCC CAAGGACTTG
481      AGGTTTATTC CTGACCCCAA GGCGGGCATC ATGATCAAAA GTGTGAAACG CGCCTACCAT
541      CGGCTCTGTC TGCATTGTTC TGTGGACCAG GAGGGCAAGT CAGTGCTGTC GGAAAAATTC
601      ATCCTGAAAG TGAGGCCAGC CTTCAAAGCT GTGCCTGTTG TGTCTGTGTC CAAAGCAAGC
661      TATCTTCTTA GGGAAGGGGA AGAATTCACA GTGACGTGCA CAATAAAAGA TGTGTCTAGT
721      TCTGTGTACT CAACGTGGAA AAGAGAAAAC AGTCAGACTA AACTACAGGA GAAATATAAT
781      AGCTGGCATC ACGGTGACTT CAATTATGAA CGTCAGGCAA CGTTGACTAT CAGTTCAGCG
841      AGAGTTAATG ATTCTGGAGT GTTCATGTGT TATGCCAATA ATACTTTTGG ATCAGCAAAT
901      GTCACAACAA CCTTGGAAGT AGTAGATAAA GGATTCATTA ATATCTTCCC CATGATAAAC
961      ACTACAGTAT TTGTAAACGA TGGAGAAAAT GTAGATTTGA TTGTTGAATA TGAAGCATTC
1021     CCCAAACCTG AACACCAGCA GTGGATCTAT ATGAACAGAA CCTTCACTGA TAAATGGGAA
1081     GATTATCCCA AGTCTGAGAA TGAAAGTAAT ATCAGATACG TAAGTGAACT TCATCTAACG
1141     AGATTAAAAG GCACCGAAGG AGGCACTTAC ACATTCCTAG TGTCCAATTC TGACGTCAAT
1201     GCTGCCATAG CATTTAATGT TTATGTGAAT ACAAAACCAG AAATCCTGAC TTACGACAGG
1261     CTCGTGAATG GCATGCTCCA ATGTGTGGCA GCAGGATTCC CAGAGCCCAC AATAGATTGG
1321     TATTTTTGTC CAGGAACTGA GCAGAGATGC TCTGCTTCTG TACTGCCAGT GGATGTGCAG
1381     ACACTAAACT CATCTGGGCC ACCGTTTGGA AAGCTAGTGG TTCAGAGTTC TATAGATTCT
1441     AGTGCATTCA AGCACAATGG CACGGTTGAA TGTAAGGCTT ACAACGATGT GGGCAAGACT
1501     TCTGCCTATT TTAACTTTGC ATTTAAAGAG CAAATCCATC CCCACACCCT GTTCACTCCT
1561     TTGCTGATTG GTTTCGTAAT CGTAGCTGGC ATGATGTGCA TTATTGTGAT GATTCTGACC
1621     TACAAATATT TACAGAAACC CATGTATGAA GTACAGTGGA AGGTTGTTGA GGAGATAAAT
1681     GGAAACAATT ATGTTTACAT AGACCCAACA CAACTTCCTT ATGATCACAA ATGGGAGTTT
1741     CCCAGAAACA GGCTGAGTTT TGGGAAAACC CTGGGTGCTG GAGCTTTCGG GAAGGTTGTT
1801     GAGGCAACTG CTTATGGCTT AATTAAGTCA GATGCGGCCA TGACTGTCGC TGTAAAGATG
1861     CTCAAGCCGA GTGCCCATTT GACAGAACGG GAAGCCCTCA TGTCTGAACT CAAAGTCCTG
1921     AGTTACCTTG GTAATCACAT GAATATTGTG AATCTACTTG GAGCCTGCAC CATTGGAGGG
1981     CCCACCCTGG TCATTACAGA ATATTGTTGC TATGGTGATC TTTTGAATTT TTTGAGAAGA
2041     AAACGTGATT CATTTATTTG TTCAAAGCAG GAAGATCATG CAGAAGCTGC ACTTTATAAG
2101     AATCTTCTGC ATTCAAAGGA GTCTTCCTGC AGCGATAGTA CTAATGAGTA CATGGACATG
2161     AAACCTGGAG TTTCTTATGT TGTCCCAACC AAGGCCGACA AAAGGAGATC TGTGAGAATA
2221     GGCTCATACA TAGAAAGAGA TGTGACTCCC GCCATCATGG AGGATGACGA GTTGGCCCTA
2281     GACTTAGAAG ACTTGCTGAG CTTTTCTTAC CAGGTGGCAA AGGGCATGGC TTTCCTCGCC
2341     TCCAAGAATT GTATTCACAG AGACTTGGCA GCCAGAAATA TCCTCCTTAC TCATGGTCGG
2401     ATCACAAAGA TTTGTGATTT TGGTCTAGCC AGAGACATCA AGAATGATTC TAATTATGTG
2461     GTTAAAGGAA ACGCTCGACT ACCTGTGAAG TGGATGGCAC CTGAAAGCAT TTTCAACTGT
2521     GTATACACGT TTGAAAGTGA CGTCTGGTCC TATGGGATTT TTCTTTGGGA GCTGTTCTCT
2581     TTAGGAAGCA GCCCCTATCC TGGAATGCCG GTCGATTCTA AGTTCTACAA GATGATCAAG
2641     GAAGGCTTCC GGATGCTCAG CCCTGAACAC GCACCTGCTG AAATGTATGA CATAATGAAG
2701     ACTTGCTGGG ATGCAGATCC CCTAAAAAGA CCAACATTCA AGCAAATTGT TCAGCTAATT
2761     GAGAAGCAGA TTTCAGAGAG CACCAATCAT ATTTACTCCA ACTTAGCAAA CTGCAGCCCC
2821     AACCGACAGA AGCCCGTGGT AGACCATTCT GTGCGGATCA ATTCTGTCGG CAGCACCGCT
2881     TCCTCCTCCC AGCCTCTGCT TGTGCACGAC GATGTCGCT1G ATTACAAGGA TGACGACGAT
2941     AAG2TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. FLAG Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"