After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SARS coronavirus (SARS-CoV) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized)

DatasheetReviewsRelated ProductsProtocols
SARS NP-CoV cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1269bp
cDNA Description:Full length Clone DNA of Human SARS coronavirus (SARS-CoV) Nucleoprotein / NP DNA.
Gene Synonym:NP-CoV
Restriction Site:HindIII + XhoI (5.5kb + 1.27kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with NP_828858.1.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
SARS NP-CoV Gene Plasmid Map
Human SARS coronavirus (SARS-CoV) Nucleoprotein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human SARS coronavirus (SARS-CoV) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name

Coronaviruses are enveloped viruses with a positive-sense RNA genome and with a nucleocapsid of helical symmetry. Coronaviruses primarily cause respiratory and enteric diseases in mammals and birds. Coronaviruses can cause a range of symptoms varying from mild symptoms such as the common cold to more serious respiratory illnesses. They primarily cause respiratory and enteric diseases in mammals and birds. Coronavirus symptoms include rhinorrhea, sneezing, cough, nasal obstruction, bronchitis and so on. There are three main groups of coronaviruses: alpha, beta, and gamma. Proteins that contribute to the overall structure of all coronaviruses are the spike (S), envelope (E), membrane (M) and nucleoprotein (N). Coronavirus nucleoproteins localize to the cytoplasm and the nucleolus, a subnuclear structure, in both virus-infected primary cells and in cells transfected with plasmids that express N protein. Coronavirus N protein is required for coronavirus RNA synthesis, and has RNA chaperone activity that may be involved in template switch.

  1. 1.Van Boheemen S, et al. (2012), MBio. 3(6):e00473-12.
  2. Bisht H. et al., 2004, Proc Natl Acad Sci. 101 (17): 6641-6.
  3. Li W. et al., 2005, Science. 309 (5742): 1864-8.
Size / Price
Catalog: VG40143-G-N
List Price: 
Price:      (You Save: )
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.