S6K1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10099-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All S6K1 Reagents
CRO Services

All S6K1 Reagents
S6K1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1578 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
S6K1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S6K1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human G-CSF/CSF3 Gene Plasmid Map 7153
S6K1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
p70 S6KA cDNA ORF Clone, Human;p70(S6K)-alpha cDNA ORF Clone, Human;p70-alpha cDNA ORF Clone, Human;p70-S6K cDNA ORF Clone, Human;PS6K cDNA ORF Clone, Human;RPS6KB1 cDNA ORF Clone, Human;S6K cDNA ORF Clone, Human;S6K-beta-1 cDNA ORF Clone, Human;S6K1 cDNA ORF Clone, Human;STK14A cDNA ORF Clone, Human
S6K1 Background Information

PS6K, also known as RPS6KB1, is a serine/threonine-protein kinase. It belongs to the RSK (ribosomal s6 kinase) family. Members of this family function in signal transduction. PS6K is an isoform of p70 ribosomal S6 kinase (S6K). S6K can be activated by mitogenic stimuli such as growth factors, insulin and cytokines. It phosphorylates the ribosomal protein S6. PS6K also phosphorylates other proteins such as elF4B, eEF2K and SKAR. It is a crucial effector of mTOR(rapamycin) signaling. PS6K is dissociated from the EIF3 complex and activated upon mitogenic stimulation, phosphorylation by the mammalian target of mTOR complex 1 (mTORC1). Its active form then phosphorylates and activates several substrates in the preinitiation complex, including the EIF2B complex and the cap-binding complex component EIF4B. PS6K also functions in cell proliferation, cell growth and cell cycle progression.

Full Name
ribosomal protein S6 kinase, polypeptide 1
References
  • Panasyuk, et al. (2006) Nuclear export of PS6K II is regulated by protein kinase CK2 phosphorylation at Ser-17. J Biol Chem. 281(42):31188-201.
  • Carnevalli L, et al. (2010) PS6K Plays a Critical Role in Early Adipocyte Differentiation. Dev Cell. 18 (5):763-74.
  • Grove JR, et al. (1991) Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol Cell Biol. 11(11):5541-50.
  • S6K1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    S6K1 cDNA ORF Clone in Cloning Vector, Rat RG81937-U
    S6K1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81937-ACGLN

    S6K1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    S6K1 cDNA ORF Clone in Cloning Vector, Mouse MG57388-U
    S6K1 cDNA ORF Clone, Mouse, untagged MG57388-UT
    S6K1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57388-ACGLN
    S6K1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57388-ACG
    S6K1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57388-ANG
    S6K1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57388-ACR
    S6K1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57388-ANR
    S6K1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57388-CF
    S6K1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57388-NF
    S6K1 cDNA ORF Clone, Mouse, C-His tag MG57388-CH
    S6K1 cDNA ORF Clone, Mouse, N-His tag MG57388-NH
    S6K1 cDNA ORF Clone, Mouse, C-HA tag MG57388-CY
    S6K1 cDNA ORF Clone, Mouse, N-HA tag MG57388-NY
    S6K1 cDNA ORF Clone, Mouse, C-Myc tag MG57388-CM
    S6K1 cDNA ORF Clone, Mouse, N-Myc tag MG57388-NM

    S6K1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    S6K1 cDNA ORF Clone in Cloning Vector, Human HG10099-M
    S6K1 cDNA ORF Clone, Human, untagged HG10099-UT
    S6K1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10099-ACGLN
    S6K1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10099-ACG
    S6K1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10099-ANG
    S6K1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10099-ACR
    S6K1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10099-ANR
    S6K1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10099-CF
    S6K1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10099-NF
    S6K1 cDNA ORF Clone, Human, C-His tag HG10099-CH
    S6K1 cDNA ORF Clone, Human, N-His tag HG10099-NH
    S6K1 cDNA ORF Clone, Human, C-HA tag HG10099-CY
    S6K1 cDNA ORF Clone, Human, N-HA tag HG10099-NY
    S6K1 cDNA ORF Clone, Human, C-Myc tag HG10099-CM
    S6K1 cDNA ORF Clone, Human, N-Myc tag HG10099-NM
    S6K1 qPCR Primer Pairs, Human HP100180
    info info
    添加购物车成功! 添加购物车失败!