Quick Order

Text Size:AAA

Human S100B Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human S100B cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human S100B Gene Plasmid Map
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

S100B is a member of the S100 family of proteins containing two EF-hand-type calcium-binding motifs. S100B exerts both intracellular and extracellular functions. Intracellular S100B acts as a stimulator of cell proliferation and migration and an inhibitor of apoptosis and differentiation, which might have important implications during brain, cartilage and skeletal muscle development and repair, activation of astrocytes in the course of brain damage and neurodegenerative processes, and of cardiomyocyte remodeling after infarction, as well as in melanomagenesis and gliomagenesis. As an extracellular factor, S100B engages RAGE (receptor for advanced glycation end products) in a variety of cell types with different outcomes (i.e. beneficial or detrimental, pro-proliferative or pro-differentiative) depending on the concentration attained by the protein, the cell type and the microenvironment. This calcium binding astrocyte-specific cytokine, presents a marker of astrocytic activation and reflects CNS injury. The excellent sensitivity of S100B has enabled it to confirm the existence of subtle brain injury in patients with mild head trauma, strokes, and after successful resuscitation from cardiopulmonary arrest. Recent findings provide evidence, that S100B may decrease neuronal injury and/or contribute to repair following traumatic brain injury (TBI). Hence, S100B, far from being a negative determinant of outcome, as suggested previously in the human TBI and ischemia literature, is of potential therapeutic value that could improve outcome in patients who sustain various forms of acute brain damage.

References
  • Kleindienst A, et al. (2006) A critical analysis of the role of the neurotrophic protein S100B in acute brain injury. J Neurotrauma. 23(8): 1185-200.
  • Bloomfield SM, et al. (2007) Reliability of S100B in predicting severity of central nervous system injury. Neurocrit Care. 6(2): 121-38.
  • Donato R, et al. (2009) S100B's double life: intracellular regulator and extracellular signal. Biochim Biophys Acta. 1793(6): 1008-22.
  • Beaudeux JL. (2009) S100B protein: a novel biomarker for the diagnosis of head injury. Ann Pharm Fr. Beaudeux JL. 67(3): 187-94.
  • Contact Us
    Images
    • Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"