S100A4 cDNA ORF Clone, Human, untagged

Cat: HG10185-M-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All S100A4 Reagents
CRO Services

All S100A4 Reagents
S100A4 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
306 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A4, transcript variant 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI (5.5kb + 0.31kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
S100A4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A4 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
S100A4 cDNA ORF Clone, Human, untagged Alternative Names
18A2 cDNA ORF Clone, Human;42A cDNA ORF Clone, Human;CAPL cDNA ORF Clone, Human;FSP1 cDNA ORF Clone, Human;MTS1 cDNA ORF Clone, Human;P9KA cDNA ORF Clone, Human;PEL98 cDNA ORF Clone, Human
S100A4 Background Information

S100A4, also known as metastasis-associated protein Mtsl, belongs to the family of small calcium-binding S100 proteins containing two EF-hand calcium-binding motifs. In humans at least 20 S100 family members that are distributed tissue specifically have been identified, and are involved in a number of cellular processes as transducers of calcium signal. S100A4 is a symmetric homodimer, and undergoes a relatively large conformational change upon the typical EF-hand binding calcium, which is necessary for S100A4 to interact with its protein targets and generate biological effects. It can bind the already known targets p53, F-actin, liprin β, myosin heavy chain II, and prevent their phosphorylation and multimerization. It has been demonstrated that S100A4 is directly involved in tumor metastasis including cell motility, invasion, apoptosis, angiogenesis and differentiation, and appears to be a metastasis factor and a molecular marker for clinical prognosis. Multiple alternatively spliced variants encoding the same protein have been identified.

Full Name
S100 calcium binding protein A4
References
  • Ambartsumian N. et al., 1995, Gene. 159: 125-30.
  • Marenholz I. et al., 2004, Biochem Biophys Res Commun. 322: 1111-22.
  • Helfman DM. et al., 2005, Br J Cancer. 92: 1955-8.
  • Saleem M. et al., 2006, Proc Natl Acad Sci. 103: 14825-30.
  • Boye K. et al., 2008, Int J Cancer. 123: 1301-10.
  • Garrett SC. et al., 2006, J Biol Chem. 281: 677-80.
  • Kriajevska M. et al., 2002, J Biol Chem. 277: 5299-335.
  • S100A4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    S100A4 cDNA ORF Clone in Cloning Vector, Mouse MG50484-M
    S100A4 cDNA ORF Clone, Mouse, untagged MG50484-UT
    S100A4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50484-ACGLN
    S100A4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50484-ACG
    S100A4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50484-ANG
    S100A4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50484-ACR
    S100A4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50484-ANR
    S100A4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50484-CF
    S100A4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50484-NF
    S100A4 cDNA ORF Clone, Mouse, C-His tag MG50484-CH
    S100A4 cDNA ORF Clone, Mouse, N-His tag MG50484-NH
    S100A4 cDNA ORF Clone, Mouse, C-HA tag MG50484-CY
    S100A4 cDNA ORF Clone, Mouse, N-HA tag MG50484-NY
    S100A4 cDNA ORF Clone, Mouse, C-Myc tag MG50484-CM
    S100A4 cDNA ORF Clone, Mouse, N-Myc tag MG50484-NM
    S100A4 qPCR Primer Pairs, Mouse MP200478

    S100A4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    S100A4 cDNA ORF Clone in Cloning Vector, Human HG10185-M
    S100A4 cDNA ORF Clone, Human, untagged HG10185-UT
    S100A4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10185-ACG
    S100A4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10185-ACGLN
    S100A4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10185-ANG
    S100A4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10185-ACR
    S100A4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10185-ANR
    S100A4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10185-CF
    S100A4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10185-NF
    S100A4 cDNA ORF Clone, Human, C-His tag HG10185-CH
    S100A4 cDNA ORF Clone, Human, N-His tag HG10185-NH
    S100A4 cDNA ORF Clone, Human, C-HA tag HG10185-CY
    S100A4 cDNA ORF Clone, Human, N-HA tag HG10185-NY
    S100A4 cDNA ORF Clone, Human, C-Myc tag HG10185-CM
    S100A4 cDNA ORF Clone, Human, N-Myc tag HG10185-NM
    S100A4 qPCR Primer Pairs, Human HP100252
    info info
    添加购物车成功! 添加购物车失败!