Quick Order

Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid

  • Human S100A4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human S100A4 cDNA Clone Product Information
NCBI RefSeq:NM_002961.2
RefSeq ORF Size:306bp
cDNA Description:Full length Clone DNA of Homo sapiens S100 calcium binding protein A4, transcript variant 1.
Gene Synonym:S100A4, 42A, 18A2, CAPL, FSP1, MTS1, P9KA, PEL98
Restriction Site:KpnI + XhoI (5.5kb + 0.31kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
( We provide with S100A4 qPCR primers for gene expression analysis, HP100252 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human S100A4 Gene Plasmid Map
Human S100A4 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name

S100A4, also known as metastasis-associated protein Mtsl, belongs to the family of small calcium-binding S100 proteins containing two EF-hand calcium-binding motifs. In humans at least 20 S100 family members that are distributed tissue specifically have been identified, and are involved in a number of cellular processes as transducers of calcium signal. S100A4 is a symmetric homodimer, and undergoes a relatively large conformational change upon the typical EF-hand binding calcium, which is necessary for S100A4 to interact with its protein targets and generate biological effects. It can bind the already known targets p53, F-actin, liprin β, myosin heavy chain II, and prevent their phosphorylation and multimerization. It has been demonstrated that S100A4 is directly involved in tumor metastasis including cell motility, invasion, apoptosis, angiogenesis and differentiation, and appears to be a metastasis factor and a molecular marker for clinical prognosis. Multiple alternatively spliced variants encoding the same protein have been identified.

  • Ambartsumian N. et al., 1995, Gene. 159: 125-30.
  • Marenholz I. et al., 2004, Biochem Biophys Res Commun. 322: 1111-22.
  • Helfman DM. et al., 2005, Br J Cancer. 92: 1955-8.
  • Saleem M. et al., 2006, Proc Natl Acad Sci. 103: 14825-30.
  • Boye K. et al., 2008, Int J Cancer. 123: 1301-10.
  • Garrett SC. et al., 2006, J Biol Chem. 281: 677-80.
  • Kriajevska M. et al., 2002, J Biol Chem. 277: 5299-335.
  • Size / Price
    Catalog: HG10185-M-N
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.