After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human S100A2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human S100A2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human S100A2 Gene Plasmid Map
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

The calcium-binding Protein S100A2 is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 family genes are located as a cluster on chromosome 1q21, and S100 proteins consisting of at least 20 members are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation. S100A2 was first detected in lung and kidney, and is mainly expressed in a subset of tissues and cells such as breast epithelia and liver. The S100A2 protein is a homodimer that undergoes a conformational change upon binding of calcium, and the active form functions in regulating cell proliferation and differentiation, gene transcription, and p53-dependent growth arrest and apoptosis. Accordingly, this protein is regarded as a putative tumor suppressor, and thus chromosomal rearrangements and reduced expression of S100A2 gene have been implicated in certain carcinomas.

References
  • Gimona, M. et al., 1997, J. Cell. Sci. 110: 611-621.
  • Mueller, A. et al., 2005, J. Biol. Chem. 280: 29186-29193.
  • Lapi, E. et al., 2006, Oncogene. 25: 3628-3637.
  • Feng, G. et al., 2001, Cancer. Res. 61: 7999-8004.
  • Gupta, S. et al., 2003, J. Clin. Oncol. 21: 106-112.
  • Contact Us
    Images
    • Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"