14-3-3 eta cDNA ORF Clone, Rat, N-HA tag

Cat: RG80661-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All 14-3-3 eta Reagents
CRO Services
Product recommended

All 14-3-3 eta Reagents
14-3-3 eta cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
741 bp
Description
Full length Clone DNA of Rat tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

14-3-3 eta Background Information
Full Name
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta
References
  • Wakui H, et al. (1997) Interaction of the ligand-activated glucocorticoid receptor with the 14-3-3 eta protein. J Biol Chem. 272(13): 8153-6.
  • Toyooka K, et al. (2002) Isolation and structure of the mouse 14-3-3 eta chain gene and the distribution of 14-3-3 eta mRNA in the mouse brain. Brain Res Mol Brain Res. 100(1-2): 13-20.
  • Kim YS, et al. (2005) Role of 14-3-3 eta as a positive regulator of the glucocorticoid receptor transcriptional activation. Endocrinology. 146(7): 3133-40.
  • Grover D, et al. (2009) Family-based association of YWHAH in psychotic bipolar disorder. Am J Med Genet B Neuropsychiatr Genet. 150B(7): 977-83.
  • 14-3-3 eta cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    14-3-3 eta cDNA ORF Clone in Cloning Vector, Rat RG80661-U
    14-3-3 eta cDNA ORF Clone, Rat, untagged RG80661-UT
    14-3-3 eta cDNA ORF Clone, Rat, C-GFPSpark® tag RG80661-ACG
    14-3-3 eta Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80661-ACGLN
    14-3-3 eta cDNA ORF Clone, Rat, N-GFPSpark® tag RG80661-ANG
    14-3-3 eta cDNA ORF Clone, Rat, C-OFPSpark® tag RG80661-ACR
    14-3-3 eta cDNA ORF Clone, Rat, N-OFPSpark® tag RG80661-ANR
    14-3-3 eta cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80661-CF
    14-3-3 eta cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80661-NF
    14-3-3 eta cDNA ORF Clone, Rat, C-His tag RG80661-CH
    14-3-3 eta cDNA ORF Clone, Rat, N-His tag RG80661-NH
    14-3-3 eta cDNA ORF Clone, Rat, C-HA tag RG80661-CY
    14-3-3 eta cDNA ORF Clone, Rat, C-Myc tag RG80661-CM
    14-3-3 eta cDNA ORF Clone, Rat, N-Myc tag RG80661-NM
    14-3-3 eta qPCR Primer Pairs, Rat RP300625

    14-3-3 eta cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    14-3-3 eta cDNA ORF Clone in Cloning Vector, Mouse MG50864-G
    14-3-3 eta cDNA ORF Clone, Mouse, untagged MG50864-UT
    14-3-3 eta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50864-ACGLN
    14-3-3 eta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50864-ACG
    14-3-3 eta cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50864-ANG
    14-3-3 eta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50864-ACR
    14-3-3 eta cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50864-ANR
    14-3-3 eta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50864-CF
    14-3-3 eta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50864-NF
    14-3-3 eta cDNA ORF Clone, Mouse, C-His tag MG50864-CH
    14-3-3 eta cDNA ORF Clone, Mouse, N-His tag MG50864-NH
    14-3-3 eta cDNA ORF Clone, Mouse, C-HA tag MG50864-CY
    14-3-3 eta cDNA ORF Clone, Mouse, N-HA tag MG50864-NY
    14-3-3 eta cDNA ORF Clone, Mouse, C-Myc tag MG50864-CM
    14-3-3 eta cDNA ORF Clone, Mouse, N-Myc tag MG50864-NM
    14-3-3 eta qPCR Primer Pairs, Mouse MP200835

    14-3-3 eta cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    14-3-3 eta cDNA ORF Clone in Cloning Vector, Human HG10847-M
    14-3-3 eta cDNA ORF Clone, Human, untagged HG10847-UT
    14-3-3 eta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10847-ACGLN
    14-3-3 eta cDNA ORF Clone, Human, C-GFPSpark® tag HG10847-ACG
    14-3-3 eta cDNA ORF Clone, Human, N-GFPSpark® tag HG10847-ANG
    14-3-3 eta cDNA ORF Clone, Human, C-OFPSpark® tag HG10847-ACR
    14-3-3 eta cDNA ORF Clone, Human, N-OFPSpark® tag HG10847-ANR
    14-3-3 eta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10847-CF
    14-3-3 eta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10847-NF
    14-3-3 eta cDNA ORF Clone, Human, C-His tag HG10847-CH
    14-3-3 eta cDNA ORF Clone, Human, N-His tag HG10847-NH
    14-3-3 eta cDNA ORF Clone, Human, C-HA tag HG10847-CY
    14-3-3 eta cDNA ORF Clone, Human, N-HA tag HG10847-NY
    14-3-3 eta cDNA ORF Clone, Human, C-Myc tag HG10847-CM
    14-3-3 eta cDNA ORF Clone, Human, N-Myc tag HG10847-NM
    14-3-3 eta qPCR Primer Pairs, Human HP100744
    info info
    添加购物车成功! 添加购物车失败!