XPNPEP1 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81201-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All XPNPEP1 Reagents
CRO Services
Product recommended

All XPNPEP1 Reagents
XPNPEP1 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1872 bp
Description
Full length Clone DNA of Rat X-prolyl aminopeptidase (aminopeptidase P) 1, soluble with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

XPNPEP1 Background Information
Full Name
X-prolyl aminopeptidase (aminopeptidase P) 1, soluble

XPNPEP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
XPNPEP1 cDNA ORF Clone in Cloning Vector, Rat RG81201-U
XPNPEP1 cDNA ORF Clone, Rat, untagged RG81201-UT
XPNPEP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81201-ACGLN
XPNPEP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81201-ACG
XPNPEP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81201-ANG
XPNPEP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81201-ACR
XPNPEP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81201-ANR
XPNPEP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81201-CF
XPNPEP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81201-NF
XPNPEP1 cDNA ORF Clone, Rat, C-His tag RG81201-CH
XPNPEP1 cDNA ORF Clone, Rat, N-His tag RG81201-NH
XPNPEP1 cDNA ORF Clone, Rat, C-HA tag RG81201-CY
XPNPEP1 cDNA ORF Clone, Rat, N-HA tag RG81201-NY
XPNPEP1 cDNA ORF Clone, Rat, N-Myc tag RG81201-NM
XPNPEP1 qPCR Primer Pairs, Rat RP301157

XPNPEP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
XPNPEP1 cDNA ORF Clone in Cloning Vector, Mouse MG50798-G
XPNPEP1 cDNA ORF Clone, Mouse, untagged MG50798-UT
XPNPEP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50798-ACG
XPNPEP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50798-ACGLN
XPNPEP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50798-ANG
XPNPEP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50798-ACR
XPNPEP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50798-ANR
XPNPEP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50798-CF
XPNPEP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50798-NF
XPNPEP1 cDNA ORF Clone, Mouse, C-His tag MG50798-CH
XPNPEP1 cDNA ORF Clone, Mouse, N-His tag MG50798-NH
XPNPEP1 cDNA ORF Clone, Mouse, C-HA tag MG50798-CY
XPNPEP1 cDNA ORF Clone, Mouse, N-HA tag MG50798-NY
XPNPEP1 cDNA ORF Clone, Mouse, C-Myc tag MG50798-CM
XPNPEP1 cDNA ORF Clone, Mouse, N-Myc tag MG50798-NM
XPNPEP1 qPCR Primer Pairs, Mouse MP200769

XPNPEP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
XPNPEP1 cDNA ORF Clone in Cloning Vector, Human HG10553-M
XPNPEP1 cDNA ORF Clone, Human, untagged HG10553-UT
XPNPEP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10553-ACGLN
XPNPEP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10553-ACG
XPNPEP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10553-ANG
XPNPEP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10553-ACR
XPNPEP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10553-ANR
XPNPEP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10553-CF
XPNPEP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10553-NF
XPNPEP1 cDNA ORF Clone, Human, C-His tag HG10553-CH
XPNPEP1 cDNA ORF Clone, Human, N-His tag HG10553-NH
XPNPEP1 cDNA ORF Clone, Human, C-HA tag HG10553-CY
XPNPEP1 cDNA ORF Clone, Human, N-HA tag HG10553-NY
XPNPEP1 cDNA ORF Clone, Human, C-Myc tag HG10553-CM
XPNPEP1 cDNA ORF Clone, Human, N-Myc tag HG10553-NM
XPNPEP1 qPCR Primer Pairs, Human HP100566
info info
添加购物车成功! 添加购物车失败!