HE4 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80084-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HE4 Reagents
CRO Services
Product recommended

All HE4 Reagents
HE4 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
363 bp
Description
Full length Clone DNA of Rat WAP four-disulfide core domain 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HE4 Background Information

WAP four-disulfide core domain protein 2, also known as Epididymal secretory protein E4, Major epididymis-specific protein E4, Putative protease inhibitor WAP5, WFDC2 and HE4, is a secreted protein which contains two WAP domains. WFDC2 / HE4 is a member of a family of stable 4-disulfide core proteins that are secreted at high levels. It is expressed in a number of normal tissues, including male reproductive system, regions of the respiratory tract and nasopharynx. It is highly expressed in a number of tumors cells lines, such ovarian, colon, breast, lung and renal cells lines. Initially described as being exclusively transcribed in the epididymis. WFDC2 may be a component of the innate immune defences of the lung, nasal and oral cavities and suggest that WFDC2 functions in concert with related WAP domain containing proteins in epithelial host defence. WFDC2 re-expression in lung carcinomas may prove to be associated with tumour type and should be studied in further detail. Mammary gland expression of tammar WFDC2 during the course of lactation showed WFDC2 was elevated during pregnancy, reduced in early lactation and absent in mid-late lactation. WFDC2 / HE4 can undergo a complex series of alternative splicing events that can potentially yield five distinct WAP domain containing protein isoforms.

Full Name
WAP four-disulfide core domain 2
References
  • Bingle,L. et al., 2002, Oncogene. 21 (17):2768-73.
  • Hellström,I. et al., 2003, Cancer Res. 63 (13):3695-700.
  • Bingle,L. et al., 2006, Respir Res. 7 : 61.
  • Galgano,M.T. et al., 2006, Mod Pathol.19 (6):847-53.
  • Sharp,J.A. et al., 2007, Evol Dev. 9 (4): 378-92.
  • HE4 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    HE4 cDNA ORF Clone in Cloning Vector, Canine DG70012-G
    HE4 cDNA ORF Clone, Canine, untagged DG70012-UT
    HE4 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70012-ACGLN
    HE4 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70012-ACG
    HE4 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70012-ACR
    HE4 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70012-CF
    HE4 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70012-NF
    HE4 cDNA ORF Clone, Canine, C-His tag DG70012-CH
    HE4 cDNA ORF Clone, Canine, N-His tag DG70012-NH
    HE4 cDNA ORF Clone, Canine, C-HA tag DG70012-CY
    HE4 cDNA ORF Clone, Canine, N-HA tag DG70012-NY
    HE4 cDNA ORF Clone, Canine, C-Myc tag DG70012-CM
    HE4 cDNA ORF Clone, Canine, N-Myc tag DG70012-NM

    HE4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    HE4 cDNA ORF Clone in Cloning Vector, Rat RG80084-G
    HE4 cDNA ORF Clone, Rat, untagged RG80084-UT
    HE4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80084-ACG
    HE4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80084-ACGLN
    HE4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80084-ACR
    HE4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80084-CF
    HE4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80084-NF
    HE4 cDNA ORF Clone, Rat, C-His tag RG80084-CH
    HE4 cDNA ORF Clone, Rat, N-His tag RG80084-NH
    HE4 cDNA ORF Clone, Rat, C-HA tag RG80084-CY
    HE4 cDNA ORF Clone, Rat, N-HA tag RG80084-NY
    HE4 cDNA ORF Clone, Rat, N-Myc tag RG80084-NM
    HE4 qPCR Primer Pairs, Rat RP300080

    HE4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    HE4 cDNA ORF Clone in Cloning Vector, Mouse MG50715-G
    HE4 cDNA ORF Clone, Mouse, untagged MG50715-UT
    HE4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50715-ACG
    HE4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50715-ACGLN
    HE4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50715-ACR
    HE4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50715-CF
    HE4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50715-NF
    HE4 cDNA ORF Clone, Mouse, C-His tag MG50715-CH
    HE4 cDNA ORF Clone, Mouse, N-His tag MG50715-NH
    HE4 cDNA ORF Clone, Mouse, C-HA tag MG50715-CY
    HE4 cDNA ORF Clone, Mouse, N-HA tag MG50715-NY
    HE4 cDNA ORF Clone, Mouse, C-Myc tag MG50715-CM
    HE4 cDNA ORF Clone, Mouse, N-Myc tag MG50715-NM
    HE4 qPCR Primer Pairs, Mouse MP200690

    HE4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    HE4 cDNA ORF Clone, Human, untagged HG12609-UT
    HE4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12609-ACGLN
    info info
    添加购物车成功! 添加购物车失败!