WDR12 cDNA ORF Clone, Rat, untagged

Cat: RG81068-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All WDR12 Reagents
CRO Services
Product recommended

All WDR12 Reagents
WDR12 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1272 bp
Description
Full length Clone DNA of Rat WD repeat domain 12.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WDR12 Background Information
Full Name
WD repeat domain 12

WDR12 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
WDR12 cDNA ORF Clone in Cloning Vector, Rat RG81068-U
WDR12 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81068-ACG
WDR12 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81068-ACGLN
WDR12 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81068-ANG
WDR12 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81068-ACR
WDR12 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81068-ANR
WDR12 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81068-CF
WDR12 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81068-NF
WDR12 cDNA ORF Clone, Rat, C-His tag RG81068-CH
WDR12 cDNA ORF Clone, Rat, N-His tag RG81068-NH
WDR12 cDNA ORF Clone, Rat, C-HA tag RG81068-CY
WDR12 cDNA ORF Clone, Rat, N-HA tag RG81068-NY
WDR12 cDNA ORF Clone, Rat, C-Myc tag RG81068-CM
WDR12 cDNA ORF Clone, Rat, N-Myc tag RG81068-NM
WDR12 qPCR Primer Pairs, Rat RP301032

WDR12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
WDR12 cDNA ORF Clone in Cloning Vector, Mouse MG51802-G
WDR12 cDNA ORF Clone, Mouse, untagged MG51802-UT
WDR12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51802-ACGLN
WDR12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51802-ACG
WDR12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51802-ANG
WDR12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51802-ACR
WDR12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51802-ANR
WDR12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51802-CF
WDR12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51802-NF
WDR12 cDNA ORF Clone, Mouse, C-His tag MG51802-CH
WDR12 cDNA ORF Clone, Mouse, N-His tag MG51802-NH
WDR12 cDNA ORF Clone, Mouse, C-HA tag MG51802-CY
WDR12 cDNA ORF Clone, Mouse, N-HA tag MG51802-NY
WDR12 cDNA ORF Clone, Mouse, C-Myc tag MG51802-CM
WDR12 cDNA ORF Clone, Mouse, N-Myc tag MG51802-NM
WDR12 qPCR Primer Pairs, Mouse MP201675

WDR12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
WDR12 cDNA ORF Clone in Cloning Vector, Human HG22656-U
WDR12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22656-ACGLN
info info
添加购物车成功! 添加购物车失败!