VPS53 cDNA ORF Clone, Rat, untagged

Cat: RG81179-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VPS53 Reagents
CRO Services
Product recommended

All VPS53 Reagents
VPS53 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2499 bp
Description
Full length Clone DNA of Rat vacuolar protein sorting 53 homolog (S. cerevisiae).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VPS53 Background Information
Full Name
vacuolar protein sorting 53 homolog (S. cerevisiae)

VPS53 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VPS53 cDNA ORF Clone in Cloning Vector, Rat RG81179-U
VPS53 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81179-ACGLN
VPS53 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81179-ACG
VPS53 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81179-ACR
VPS53 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81179-CF
VPS53 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81179-NF
VPS53 cDNA ORF Clone, Rat, C-His tag RG81179-CH
VPS53 cDNA ORF Clone, Rat, N-His tag RG81179-NH
VPS53 cDNA ORF Clone, Rat, C-HA tag RG81179-CY
VPS53 cDNA ORF Clone, Rat, N-HA tag RG81179-NY
VPS53 cDNA ORF Clone, Rat, C-Myc tag RG81179-CM
VPS53 cDNA ORF Clone, Rat, N-Myc tag RG81179-NM
VPS53 qPCR Primer Pairs, Rat RP301135

VPS53 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VPS53 cDNA ORF Clone in Cloning Vector, Mouse MG51341-U
VPS53 cDNA ORF Clone, Mouse, untagged MG51341-UT
VPS53 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51341-ACGLN
VPS53 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51341-ACG
VPS53 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51341-ACR
VPS53 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51341-CF
VPS53 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51341-NF
VPS53 cDNA ORF Clone, Mouse, C-His tag MG51341-CH
VPS53 cDNA ORF Clone, Mouse, N-His tag MG51341-NH
VPS53 cDNA ORF Clone, Mouse, C-HA tag MG51341-CY
VPS53 cDNA ORF Clone, Mouse, N-HA tag MG51341-NY
VPS53 cDNA ORF Clone, Mouse, C-Myc tag MG51341-CM
VPS53 cDNA ORF Clone, Mouse, N-Myc tag MG51341-NM
VPS53 qPCR Primer Pairs, Mouse MP201218

VPS53 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VPS53 cDNA ORF Clone, Human, untagged HG22515-UT
info info
添加购物车成功! 添加购物车失败!