VPS25 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81624-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All VPS25 Reagents
CRO Services
Product recommended

All VPS25 Reagents
VPS25 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Rat vacuolar protein sorting 25 homolog (S. cerevisiae) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VPS25 Background Information
Full Name
vacuolar protein sorting 25 homolog (S. cerevisiae)

VPS25 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VPS25 cDNA ORF Clone in Cloning Vector, Rat RG81624-G
VPS25 cDNA ORF Clone, Rat, untagged RG81624-UT
VPS25 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81624-ACGLN
VPS25 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81624-ACG
VPS25 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81624-ANG
VPS25 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81624-ACR
VPS25 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81624-ANR
VPS25 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81624-CF
VPS25 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81624-NF
VPS25 cDNA ORF Clone, Rat, C-His tag RG81624-CH
VPS25 cDNA ORF Clone, Rat, N-His tag RG81624-NH
VPS25 cDNA ORF Clone, Rat, C-HA tag RG81624-CY
VPS25 cDNA ORF Clone, Rat, N-HA tag RG81624-NY
VPS25 cDNA ORF Clone, Rat, N-Myc tag RG81624-NM

VPS25 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VPS25 cDNA ORF Clone in Cloning Vector, Human HG16145-G
VPS25 cDNA ORF Clone, Human, untagged HG16145-UT
VPS25 cDNA ORF Clone, Human, C-GFPSpark® tag HG16145-ACG
VPS25 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16145-ACGLN
VPS25 cDNA ORF Clone, Human, C-OFPSpark® tag HG16145-ACR
VPS25 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16145-CF
VPS25 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16145-NF
VPS25 cDNA ORF Clone, Human, C-His tag HG16145-CH
VPS25 cDNA ORF Clone, Human, N-His tag HG16145-NH
VPS25 cDNA ORF Clone, Human, C-HA tag HG16145-CY
VPS25 cDNA ORF Clone, Human, N-HA tag HG16145-NY
VPS25 cDNA ORF Clone, Human, C-Myc tag HG16145-CM
VPS25 cDNA ORF Clone, Human, N-Myc tag HG16145-NM
VPS25 qPCR Primer Pairs, Human HP104914
info info
添加购物车成功! 添加购物车失败!