VPS16 cDNA ORF Clone, Rat, N-His tag

Cat: RG80595-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All VPS16 Reagents
CRO Services
Product recommended

All VPS16 Reagents
VPS16 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2520 bp
Description
Full length Clone DNA of Rat vacuolar protein sorting 16 homolog (S. cerevisiae) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

VPS16 Background Information
Full Name
vacuolar protein sorting 16 homolog (S. cerevisiae)

VPS16 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
VPS16 cDNA ORF Clone in Cloning Vector, Rat RG80595-U
VPS16 cDNA ORF Clone, Rat, untagged RG80595-UT
VPS16 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80595-ACGLN
VPS16 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80595-ACG
VPS16 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80595-ANG
VPS16 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80595-ACR
VPS16 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80595-ANR
VPS16 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80595-CF
VPS16 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80595-NF
VPS16 cDNA ORF Clone, Rat, C-His tag RG80595-CH
VPS16 cDNA ORF Clone, Rat, C-HA tag RG80595-CY
VPS16 cDNA ORF Clone, Rat, N-HA tag RG80595-NY
VPS16 cDNA ORF Clone, Rat, C-Myc tag RG80595-CM
VPS16 cDNA ORF Clone, Rat, N-Myc tag RG80595-NM
VPS16 qPCR Primer Pairs, Rat RP300559

VPS16 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
VPS16 cDNA ORF Clone in Cloning Vector, Mouse MG53124-G
VPS16 cDNA ORF Clone, Mouse, untagged MG53124-UT
VPS16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53124-ACG
VPS16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53124-ACGLN
VPS16 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53124-ANG
VPS16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53124-ACR
VPS16 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53124-ANR
VPS16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53124-CF
VPS16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53124-NF
VPS16 cDNA ORF Clone, Mouse, C-His tag MG53124-CH
VPS16 cDNA ORF Clone, Mouse, N-His tag MG53124-NH
VPS16 cDNA ORF Clone, Mouse, C-HA tag MG53124-CY
VPS16 cDNA ORF Clone, Mouse, N-HA tag MG53124-NY
VPS16 cDNA ORF Clone, Mouse, C-Myc tag MG53124-CM
VPS16 cDNA ORF Clone, Mouse, N-Myc tag MG53124-NM

VPS16 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
VPS16 cDNA ORF Clone, Human, untagged HG22024-UT
info info
添加购物车成功! 添加购物车失败!